\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0708094466:

Variant ID: vg0708094466 (JBrowse)Variation Type: SNP
Chromosome: chr07Position: 8094466
Reference Allele: TAlternative Allele: C
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


AGCGCACGCCAATGCAGAAGCAGGGAATCAATCGACTACTCCAGCCCAGCACATCAGGGCCGTTCAAGCGATACTGAGGGAAACTCCTTACGATCCCGTT[T/C]
TGAACATTGACCTCGAGCGTTGGACAGAACGACTACGGGAATCGGTGACTAACCTCAGCAACGCGTTTGAAGAAGCCGCTACCGCAGCACACCATGGTGC

Reverse complement sequence

GCACCATGGTGTGCTGCGGTAGCGGCTTCTTCAAACGCGTTGCTGAGGTTAGTCACCGATTCCCGTAGTCGTTCTGTCCAACGCTCGAGGTCAATGTTCA[A/G]
AACGGGATCGTAAGGAGTTTCCCTCAGTATCGCTTGAACGGCCCTGATGTGCTGGGCTGGAGTAGTCGATTGATTCCCTGCTTCTGCATTGGCGTGCGCT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 88.10% 4.80% 3.47% 3.62% NA
All Indica  2759 96.40% 0.50% 0.94% 2.21% NA
All Japonica  1512 71.60% 13.60% 8.00% 6.81% NA
Aus  269 97.80% 0.70% 1.49% 0.00% NA
Indica I  595 99.50% 0.00% 0.17% 0.34% NA
Indica II  465 96.10% 1.90% 1.51% 0.43% NA
Indica III  913 99.20% 0.00% 0.33% 0.44% NA
Indica Intermediate  786 90.80% 0.50% 1.91% 6.74% NA
Temperate Japonica  767 50.20% 24.40% 12.52% 12.91% NA
Tropical Japonica  504 97.00% 1.00% 1.98% 0.00% NA
Japonica Intermediate  241 86.70% 5.40% 6.22% 1.66% NA
VI/Aromatic  96 83.30% 1.00% 8.33% 7.29% NA
Intermediate  90 86.70% 7.80% 5.56% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0708094466 T -> DEL N N silent_mutation Average:26.999; most accessible tissue: Minghui63 root, score: 38.567 N N N N
vg0708094466 T -> C LOC_Os07g14180.1 upstream_gene_variant ; 2712.0bp to feature; MODIFIER silent_mutation Average:26.999; most accessible tissue: Minghui63 root, score: 38.567 N N N N
vg0708094466 T -> C LOC_Os07g14190.1 upstream_gene_variant ; 170.0bp to feature; MODIFIER silent_mutation Average:26.999; most accessible tissue: Minghui63 root, score: 38.567 N N N N
vg0708094466 T -> C LOC_Os07g14200.1 upstream_gene_variant ; 2646.0bp to feature; MODIFIER silent_mutation Average:26.999; most accessible tissue: Minghui63 root, score: 38.567 N N N N
vg0708094466 T -> C LOC_Os07g14210.1 upstream_gene_variant ; 4085.0bp to feature; MODIFIER silent_mutation Average:26.999; most accessible tissue: Minghui63 root, score: 38.567 N N N N
vg0708094466 T -> C LOC_Os07g14170.1 downstream_gene_variant ; 4058.0bp to feature; MODIFIER silent_mutation Average:26.999; most accessible tissue: Minghui63 root, score: 38.567 N N N N
vg0708094466 T -> C LOC_Os07g14180-LOC_Os07g14190 intergenic_region ; MODIFIER silent_mutation Average:26.999; most accessible tissue: Minghui63 root, score: 38.567 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0708094466 4.55E-06 NA mr1154_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251