Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0708094466:

Variant ID: vg0708094466 (JBrowse)	Variation Type: SNP
Chromosome: chr07	Position: 8094466
Reference Allele: T	Alternative Allele: C
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

AGCGCACGCCAATGCAGAAGCAGGGAATCAATCGACTACTCCAGCCCAGCACATCAGGGCCGTTCAAGCGATACTGAGGGAAACTCCTTACGATCCCGTT[T/C]
TGAACATTGACCTCGAGCGTTGGACAGAACGACTACGGGAATCGGTGACTAACCTCAGCAACGCGTTTGAAGAAGCCGCTACCGCAGCACACCATGGTGC

Reverse complement sequence

GCACCATGGTGTGCTGCGGTAGCGGCTTCTTCAAACGCGTTGCTGAGGTTAGTCACCGATTCCCGTAGTCGTTCTGTCCAACGCTCGAGGTCAATGTTCA[A/G]
AACGGGATCGTAAGGAGTTTCCCTCAGTATCGCTTGAACGGCCCTGATGTGCTGGGCTGGAGTAGTCGATTGATTCCCTGCTTCTGCATTGGCGTGCGCT

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	88.10%	4.80%	3.47%	3.62%	NA
All Indica	2759	96.40%	0.50%	0.94%	2.21%	NA
All Japonica	1512	71.60%	13.60%	8.00%	6.81%	NA
Aus	269	97.80%	0.70%	1.49%	0.00%	NA
Indica I	595	99.50%	0.00%	0.17%	0.34%	NA
Indica II	465	96.10%	1.90%	1.51%	0.43%	NA
Indica III	913	99.20%	0.00%	0.33%	0.44%	NA
Indica Intermediate	786	90.80%	0.50%	1.91%	6.74%	NA
Temperate Japonica	767	50.20%	24.40%	12.52%	12.91%	NA
Tropical Japonica	504	97.00%	1.00%	1.98%	0.00%	NA
Japonica Intermediate	241	86.70%	5.40%	6.22%	1.66%	NA
VI/Aromatic	96	83.30%	1.00%	8.33%	7.29%	NA
Intermediate	90	86.70%	7.80%	5.56%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0708094466	T -> DEL	N	N	silent_mutation	Average:26.999; most accessible tissue: Minghui63 root, score: 38.567	N	N	N	N
vg0708094466	T -> C	LOC_Os07g14180.1	upstream_gene_variant ; 2712.0bp to feature; MODIFIER	silent_mutation	Average:26.999; most accessible tissue: Minghui63 root, score: 38.567	N	N	N	N
vg0708094466	T -> C	LOC_Os07g14190.1	upstream_gene_variant ; 170.0bp to feature; MODIFIER	silent_mutation	Average:26.999; most accessible tissue: Minghui63 root, score: 38.567	N	N	N	N
vg0708094466	T -> C	LOC_Os07g14200.1	upstream_gene_variant ; 2646.0bp to feature; MODIFIER	silent_mutation	Average:26.999; most accessible tissue: Minghui63 root, score: 38.567	N	N	N	N
vg0708094466	T -> C	LOC_Os07g14210.1	upstream_gene_variant ; 4085.0bp to feature; MODIFIER	silent_mutation	Average:26.999; most accessible tissue: Minghui63 root, score: 38.567	N	N	N	N
vg0708094466	T -> C	LOC_Os07g14170.1	downstream_gene_variant ; 4058.0bp to feature; MODIFIER	silent_mutation	Average:26.999; most accessible tissue: Minghui63 root, score: 38.567	N	N	N	N
vg0708094466	T -> C	LOC_Os07g14180-LOC_Os07g14190	intergenic_region ; MODIFIER	silent_mutation	Average:26.999; most accessible tissue: Minghui63 root, score: 38.567	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0708094466	4.55E-06	NA	mr1154_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251