\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0708063657:

Variant ID: vg0708063657 (JBrowse)Variation Type: INDEL
Chromosome: chr07Position: 8063657
Reference Allele: GAlternative Allele: T,GAT
Primary Allele: GSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


ACGAGGAATGACTAGTAGCATATTTAAATGGATGATAAGTAAAATTACTTATCCTTGGTCTATGTGCCAAGATTAAATATGACTATCAAAAGTAGATGGA[G/T,GAT]
GGAGTAGTAGCAAATGAAACATTAACGCTTGTGGTTATTAATCATACGTTGCACCGACGTTCCAATCGAATTAATTGCCTCCTAACTAACGGGTTTTTAC

Reverse complement sequence

GTAAAAACCCGTTAGTTAGGAGGCAATTAATTCGATTGGAACGTCGGTGCAACGTATGATTAATAACCACAAGCGTTAATGTTTCATTTGCTACTACTCC[C/A,ATC]
TCCATCTACTTTTGATAGTCATATTTAATCTTGGCACATAGACCAAGGATAAGTAATTTTACTTATCATCCATTTAAATATGCTACTAGTCATTCCTCGT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 89.00% 7.50% 1.04% 2.35% GAT: 0.11%
All Indica  2759 99.60% 0.20% 0.07% 0.00% GAT: 0.18%
All Japonica  1512 69.30% 20.60% 2.71% 7.34% NA
Aus  269 88.10% 10.00% 1.86% 0.00% NA
Indica I  595 100.00% 0.00% 0.00% 0.00% NA
Indica II  465 99.60% 0.40% 0.00% 0.00% NA
Indica III  913 99.90% 0.10% 0.00% 0.00% NA
Indica Intermediate  786 98.90% 0.30% 0.25% 0.00% GAT: 0.64%
Temperate Japonica  767 66.90% 15.80% 3.39% 13.95% NA
Tropical Japonica  504 80.60% 18.30% 1.19% 0.00% NA
Japonica Intermediate  241 53.50% 41.10% 3.73% 1.66% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 86.70% 12.20% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0708063657 G -> GAT LOC_Os07g14130.1 upstream_gene_variant ; 165.0bp to feature; MODIFIER silent_mutation Average:47.995; most accessible tissue: Minghui63 flower, score: 58.727 N N N N
vg0708063657 G -> GAT LOC_Os07g14120.1 downstream_gene_variant ; 3296.0bp to feature; MODIFIER silent_mutation Average:47.995; most accessible tissue: Minghui63 flower, score: 58.727 N N N N
vg0708063657 G -> GAT LOC_Os07g14140.1 downstream_gene_variant ; 1320.0bp to feature; MODIFIER silent_mutation Average:47.995; most accessible tissue: Minghui63 flower, score: 58.727 N N N N
vg0708063657 G -> GAT LOC_Os07g14120-LOC_Os07g14130 intergenic_region ; MODIFIER silent_mutation Average:47.995; most accessible tissue: Minghui63 flower, score: 58.727 N N N N
vg0708063657 G -> DEL N N silent_mutation Average:47.995; most accessible tissue: Minghui63 flower, score: 58.727 N N N N
vg0708063657 G -> T LOC_Os07g14130.1 upstream_gene_variant ; 166.0bp to feature; MODIFIER silent_mutation Average:47.995; most accessible tissue: Minghui63 flower, score: 58.727 N N N N
vg0708063657 G -> T LOC_Os07g14120.1 downstream_gene_variant ; 3295.0bp to feature; MODIFIER silent_mutation Average:47.995; most accessible tissue: Minghui63 flower, score: 58.727 N N N N
vg0708063657 G -> T LOC_Os07g14140.1 downstream_gene_variant ; 1321.0bp to feature; MODIFIER silent_mutation Average:47.995; most accessible tissue: Minghui63 flower, score: 58.727 N N N N
vg0708063657 G -> T LOC_Os07g14120-LOC_Os07g14130 intergenic_region ; MODIFIER silent_mutation Average:47.995; most accessible tissue: Minghui63 flower, score: 58.727 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0708063657 1.33E-06 NA mr1097 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0708063657 8.83E-06 NA mr1152 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0708063657 6.62E-06 NA mr1154 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251