Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0708004388:

Variant ID: vg0708004388 (JBrowse)	Variation Type: SNP
Chromosome: chr07	Position: 8004388
Reference Allele: G	Alternative Allele: T
Primary Allele: G	Secondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

GGAAAGAGGTATCATATGAAGTAAAACAAGAAAAAAAGGTCGATCTAGGTAGATGACGAAGCCTATGACCTTTAGGGCGTTTAACTTATTTTATTAAGTA[G/T]
ATTAGGCAACTTGACTTGATATTGTTGCTGAATATTTGTACTCCTTCCGTTTCTAAATATTTGACACCGTTGATTTTTTAGCACATGTTTGACCGTTCGT

Reverse complement sequence

ACGAACGGTCAAACATGTGCTAAAAAATCAACGGTGTCAAATATTTAGAAACGGAAGGAGTACAAATATTCAGCAACAATATCAAGTCAAGTTGCCTAAT[C/A]
TACTTAATAAAATAAGTTAAACGCCCTAAAGGTCATAGGCTTCGTCATCTACCTAGATCGACCTTTTTTTCTTGTTTTACTTCATATGATACCTCTTTCC

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	97.60%	2.40%	0.00%	0.00%	NA
All Indica	2759	100.00%	0.00%	0.00%	0.00%	NA
All Japonica	1512	92.50%	7.50%	0.00%	0.00%	NA
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	100.00%	0.00%	0.00%	0.00%	NA
Indica II	465	100.00%	0.00%	0.00%	0.00%	NA
Indica III	913	100.00%	0.00%	0.00%	0.00%	NA
Indica Intermediate	786	100.00%	0.00%	0.00%	0.00%	NA
Temperate Japonica	767	85.80%	14.20%	0.00%	0.00%	NA
Tropical Japonica	504	100.00%	0.00%	0.00%	0.00%	NA
Japonica Intermediate	241	98.30%	1.70%	0.00%	0.00%	NA
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	100.00%	0.00%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0708004388	G -> T	LOC_Os07g14010.1	upstream_gene_variant ; 620.0bp to feature; MODIFIER	silent_mutation	Average:26.193; most accessible tissue: Zhenshan97 young leaf, score: 41.197	N	N	N	N
vg0708004388	G -> T	LOC_Os07g14020.1	upstream_gene_variant ; 1281.0bp to feature; MODIFIER	silent_mutation	Average:26.193; most accessible tissue: Zhenshan97 young leaf, score: 41.197	N	N	N	N
vg0708004388	G -> T	LOC_Os07g14000.1	downstream_gene_variant ; 2904.0bp to feature; MODIFIER	silent_mutation	Average:26.193; most accessible tissue: Zhenshan97 young leaf, score: 41.197	N	N	N	N
vg0708004388	G -> T	LOC_Os07g14030.1	downstream_gene_variant ; 4939.0bp to feature; MODIFIER	silent_mutation	Average:26.193; most accessible tissue: Zhenshan97 young leaf, score: 41.197	N	N	N	N
vg0708004388	G -> T	LOC_Os07g14010-LOC_Os07g14020	intergenic_region ; MODIFIER	silent_mutation	Average:26.193; most accessible tissue: Zhenshan97 young leaf, score: 41.197	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0708004388	1.88E-07	1.88E-07	mr1528_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251