Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0707975245:

Variant ID: vg0707975245 (JBrowse)	Variation Type: INDEL
Chromosome: chr07	Position: 7975245
Reference Allele: T	Alternative Allele: TCA,A
Primary Allele: T	Secondary Allele: TCA

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

AGACTCATTCAAGTTTCTGTGGGTCAAATGAAGTGAATTATCCTAATGCTTTACAAACAAATATTATACACAATTTCCTAGCTTCCTATTTATTTTAAAA[T/TCA,A]
CACTCTAGCTCCTATATAAACTTGTTAATTTCACCTTACCTAGCTTCCTATTTATTTTAAAATCGCTGCCTCGCTGACTGGTATATTCTTTTTATGTATA

Reverse complement sequence

TATACATAAAAAGAATATACCAGTCAGCGAGGCAGCGATTTTAAAATAAATAGGAAGCTAGGTAAGGTGAAATTAACAAGTTTATATAGGAGCTAGAGTG[A/TGA,T]
TTTTAAAATAAATAGGAAGCTAGGAAATTGTGTATAATATTTGTTTGTAAAGCATTAGGATAATTCACTTCATTTGACCCACAGAAACTTGAATGAGTCT

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of TCA(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	91.10%	2.40%	2.33%	4.00%	A: 0.19%
All Indica	2759	99.50%	0.00%	0.36%	0.11%	NA
All Japonica	1512	73.60%	7.50%	6.35%	11.90%	A: 0.60%
Aus	269	99.60%	0.00%	0.37%	0.00%	NA
Indica I	595	99.70%	0.00%	0.34%	0.00%	NA
Indica II	465	98.30%	0.00%	1.29%	0.43%	NA
Indica III	913	99.90%	0.00%	0.11%	0.00%	NA
Indica Intermediate	786	99.70%	0.00%	0.13%	0.13%	NA
Temperate Japonica	767	84.70%	14.30%	0.39%	0.39%	A: 0.13%
Tropical Japonica	504	45.60%	0.00%	17.86%	34.92%	A: 1.59%
Japonica Intermediate	241	96.70%	1.70%	1.24%	0.41%	NA
VI/Aromatic	96	99.00%	0.00%	0.00%	1.04%	NA
Intermediate	90	91.10%	0.00%	3.33%	5.56%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0707975245	T -> DEL	N	N	silent_mutation	Average:54.262; most accessible tissue: Callus, score: 76.476	N	N	N	N
vg0707975245	T -> TCA	LOC_Os07g13940.1	upstream_gene_variant ; 4834.0bp to feature; MODIFIER	silent_mutation	Average:54.262; most accessible tissue: Callus, score: 76.476	N	N	N	N
vg0707975245	T -> TCA	LOC_Os07g13960.1	upstream_gene_variant ; 2672.0bp to feature; MODIFIER	silent_mutation	Average:54.262; most accessible tissue: Callus, score: 76.476	N	N	N	N
vg0707975245	T -> TCA	LOC_Os07g13950.1	intron_variant ; MODIFIER	silent_mutation	Average:54.262; most accessible tissue: Callus, score: 76.476	N	N	N	N
vg0707975245	T -> A	LOC_Os07g13940.1	upstream_gene_variant ; 4833.0bp to feature; MODIFIER	silent_mutation	Average:54.262; most accessible tissue: Callus, score: 76.476	N	N	N	N
vg0707975245	T -> A	LOC_Os07g13960.1	upstream_gene_variant ; 2673.0bp to feature; MODIFIER	silent_mutation	Average:54.262; most accessible tissue: Callus, score: 76.476	N	N	N	N
vg0707975245	T -> A	LOC_Os07g13950.1	intron_variant ; MODIFIER	silent_mutation	Average:54.262; most accessible tissue: Callus, score: 76.476	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0707975245	1.41E-07	4.70E-07	mr1068_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0707975245	NA	5.25E-06	mr1094_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0707975245	4.37E-06	4.37E-06	mr1111_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0707975245	NA	7.13E-06	mr1211_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251