Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0707884515:

Variant ID: vg0707884515 (JBrowse)Variation Type: SNP
Chromosome: chr07Position: 7884515
Reference Allele: TAlternative Allele: C
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.83, T: 0.17, others allele: 0.00, population size: 58. )

Flanking Sequence (100 bp) in Reference Genome:


CGGCCGTTGATTTGATCTCAGAGATCGCCAGCGCCGTGAGGTGGAGGAGTGGCTCGTTGAGGTGATTCCCTCCGTTCCGGATCTTCACCATTGGCGTCGC[T/C]
AGTTGGCGGCTGATCTTGGTGCGCTGCGGTAGTGGCTTCTTCAAACGCGTTGCTGAGGTTGGTCACTGATTCCCGTAGTCGTTCTGTCCAACGCTCGAGG

Reverse complement sequence

CCTCGAGCGTTGGACAGAACGACTACGGGAATCAGTGACCAACCTCAGCAACGCGTTTGAAGAAGCCACTACCGCAGCGCACCAAGATCAGCCGCCAACT[A/G]
GCGACGCCAATGGTGAAGATCCGGAACGGAGGGAATCACCTCAACGAGCCACTCCTCCACCTCACGGCGCTGGCGATCTCTGAGATCAAATCAACGGCCG

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 54.60% 40.30% 4.57% 0.47% NA
All Indica  2759 87.00% 12.30% 0.69% 0.07% NA
All Japonica  1512 1.90% 86.30% 11.84% 0.00% NA
Aus  269 41.60% 49.80% 1.12% 7.43% NA
Indica I  595 93.30% 6.70% 0.00% 0.00% NA
Indica II  465 84.70% 14.20% 1.08% 0.00% NA
Indica III  913 88.00% 11.00% 1.10% 0.00% NA
Indica Intermediate  786 82.30% 16.90% 0.51% 0.25% NA
Temperate Japonica  767 2.10% 83.30% 14.60% 0.00% NA
Tropical Japonica  504 1.80% 87.70% 10.52% 0.00% NA
Japonica Intermediate  241 1.20% 92.90% 5.81% 0.00% NA
VI/Aromatic  96 9.40% 77.10% 13.54% 0.00% NA
Intermediate  90 37.80% 60.00% 2.22% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0707884515 T -> DEL LOC_Os07g13740.1 N frameshift_variant Average:25.695; most accessible tissue: Callus, score: 34.551 N N N N
vg0707884515 T -> C LOC_Os07g13740.1 missense_variant ; p.Ser310Gly; MODERATE nonsynonymous_codon ; S310G Average:25.695; most accessible tissue: Callus, score: 34.551 benign -0.331 TOLERATED 1.00

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0707884515 NA 3.59E-07 mr1040 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0707884515 2.30E-06 NA mr1078 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0707884515 NA 2.82E-23 mr1083 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0707884515 NA 9.83E-32 mr1086 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0707884515 NA 1.12E-33 mr1104 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0707884515 NA 1.73E-29 mr1107 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0707884515 NA 2.48E-27 mr1145 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0707884515 NA 6.34E-11 mr1195 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0707884515 NA 3.93E-30 mr1204 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0707884515 NA 9.24E-24 mr1264 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0707884515 NA 4.67E-11 mr1281 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0707884515 NA 8.47E-06 mr1285 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0707884515 NA 7.63E-09 mr1342 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0707884515 NA 4.90E-11 mr1379 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0707884515 NA 2.42E-30 mr1436 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0707884515 NA 4.11E-25 mr1551 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0707884515 NA 2.58E-18 mr1552 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0707884515 NA 1.23E-07 mr1559 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0707884515 NA 5.64E-30 mr1560 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0707884515 NA 2.04E-09 mr1578 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0707884515 NA 1.36E-11 mr1581 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0707884515 NA 4.87E-13 mr1655 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0707884515 NA 1.46E-07 mr1666 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0707884515 NA 2.90E-09 mr1770 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0707884515 NA 1.39E-07 mr1804 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0707884515 NA 4.50E-09 mr1827 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0707884515 NA 1.96E-15 mr1040_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0707884515 NA 1.98E-32 mr1083_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0707884515 NA 2.36E-18 mr1131_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0707884515 NA 2.91E-17 mr1199_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0707884515 NA 1.43E-22 mr1316_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0707884515 NA 1.03E-10 mr1379_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0707884515 NA 9.70E-24 mr1551_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0707884515 NA 2.02E-13 mr1552_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0707884515 NA 9.63E-08 mr1559_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0707884515 NA 7.35E-21 mr1581_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0707884515 NA 1.75E-14 mr1720_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0707884515 NA 1.80E-06 mr1852_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0707884515 NA 7.17E-06 mr1872_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0707884515 NA 8.70E-38 mr1878_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251