\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0707877145:

Variant ID: vg0707877145 (JBrowse)Variation Type: INDEL
Chromosome: chr07Position: 7877145
Reference Allele: GAlternative Allele: A,GCAC
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.82, G: 0.18, others allele: 0.00, population size: 39. )

Flanking Sequence (100 bp) in Reference Genome:


TTCAGTGGTCAAGCAATCTCTCACACCGCAGCTTCCATCGGTGTTCGAGAGATAATTCTGCTCGCTCACTGGTTCTCGCACCAGTACGCAGCAATATCTC[G/A,GCAC]
CACTAGTCCTCAACCAGTTGATCGTAGTGATCTCTCGTACATTTGCTTCAAGTGGTCGAGTTATGGCTACTGCCTGGTCCTCGACCAGCGATGTGGCATT

Reverse complement sequence

AATGCCACATCGCTGGTCGAGGACCAGGCAGTAGCCATAACTCGACCACTTGAAGCAAATGTACGAGAGATCACTACGATCAACTGGTTGAGGACTAGTG[C/T,GTGC]
GAGATATTGCTGCGTACTGGTGCGAGAACCAGTGAGCGAGCAGAATTATCTCTCGAACACCGATGGAAGCTGCGGTGTGAGAGATTGCTTGACCACTGAA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 46.20% 25.30% 20.10% 8.32% GCAC: 0.04%
All Indica  2759 21.30% 37.30% 33.27% 8.05% GCAC: 0.07%
All Japonica  1512 86.20% 4.00% 0.20% 9.59% NA
Aus  269 59.90% 35.30% 4.83% 0.00% NA
Indica I  595 34.50% 11.40% 53.45% 0.67% NA
Indica II  465 16.10% 46.20% 29.25% 8.17% GCAC: 0.22%
Indica III  913 15.60% 47.30% 26.07% 10.95% GCAC: 0.11%
Indica Intermediate  786 21.20% 39.80% 28.75% 10.18% NA
Temperate Japonica  767 83.30% 0.90% 0.26% 15.51% NA
Tropical Japonica  504 87.90% 9.70% 0.20% 2.18% NA
Japonica Intermediate  241 91.70% 2.10% 0.00% 6.22% NA
VI/Aromatic  96 77.10% 1.00% 3.12% 18.75% NA
Intermediate  90 63.30% 13.30% 14.44% 8.89% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0707877145 G -> DEL LOC_Os07g13728.1 N frameshift_variant Average:18.203; most accessible tissue: Minghui63 panicle, score: 29.741 N N N N
vg0707877145 G -> A LOC_Os07g13728.1 missense_variant ; p.Arg67His; MODERATE nonsynonymous_codon ; R67H Average:18.203; most accessible tissue: Minghui63 panicle, score: 29.741 unknown unknown TOLERATED 0.27
vg0707877145 G -> GCAC LOC_Os07g13728.1 disruptive_inframe_insertion ; p.Thr68dup; MODERATE inframe_variant Average:18.203; most accessible tissue: Minghui63 panicle, score: 29.741 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0707877145 NA 1.77E-06 mr1076 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0707877145 NA 1.09E-06 mr1082 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0707877145 1.78E-06 3.80E-09 mr1085 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0707877145 NA 3.90E-08 mr1086 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0707877145 NA 3.56E-06 mr1088 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0707877145 NA 1.45E-08 mr1103 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0707877145 NA 7.68E-07 mr1104 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0707877145 NA 3.67E-10 mr1107 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0707877145 NA 5.01E-07 mr1139 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0707877145 NA 2.54E-07 mr1145 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0707877145 NA 1.81E-07 mr1204 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0707877145 NA 2.31E-10 mr1226 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0707877145 NA 2.21E-07 mr1246 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0707877145 NA 7.55E-07 mr1264 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0707877145 NA 5.93E-11 mr1281 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0707877145 NA 1.66E-07 mr1411 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0707877145 NA 4.99E-06 mr1436 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0707877145 NA 3.49E-08 mr1437 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0707877145 NA 8.01E-07 mr1542 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0707877145 NA 1.64E-07 mr1559 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0707877145 NA 7.99E-08 mr1560 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0707877145 NA 4.83E-06 mr1620 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0707877145 NA 1.34E-08 mr1770 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0707877145 NA 4.68E-06 mr1878 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0707877145 NA 2.84E-06 mr1949 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0707877145 NA 9.66E-06 mr1233_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0707877145 NA 2.17E-06 mr1246_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0707877145 NA 2.77E-07 mr1404_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0707877145 NA 9.06E-07 mr1559_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0707877145 NA 3.56E-06 mr1620_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0707877145 NA 4.88E-07 mr1819_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251