Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0707877145:

Variant ID: vg0707877145 (JBrowse)	Variation Type: INDEL
Chromosome: chr07	Position: 7877145
Reference Allele: G	Alternative Allele: A,GCAC
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.82, G: 0.18, others allele: 0.00, population size: 39. )

Flanking Sequence (100 bp) in Reference Genome:

TTCAGTGGTCAAGCAATCTCTCACACCGCAGCTTCCATCGGTGTTCGAGAGATAATTCTGCTCGCTCACTGGTTCTCGCACCAGTACGCAGCAATATCTC[G/A,GCAC]
CACTAGTCCTCAACCAGTTGATCGTAGTGATCTCTCGTACATTTGCTTCAAGTGGTCGAGTTATGGCTACTGCCTGGTCCTCGACCAGCGATGTGGCATT

Reverse complement sequence

AATGCCACATCGCTGGTCGAGGACCAGGCAGTAGCCATAACTCGACCACTTGAAGCAAATGTACGAGAGATCACTACGATCAACTGGTTGAGGACTAGTG[C/T,GTGC]
GAGATATTGCTGCGTACTGGTGCGAGAACCAGTGAGCGAGCAGAATTATCTCTCGAACACCGATGGAAGCTGCGGTGTGAGAGATTGCTTGACCACTGAA

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	46.20%	25.30%	20.10%	8.32%	GCAC: 0.04%
All Indica	2759	21.30%	37.30%	33.27%	8.05%	GCAC: 0.07%
All Japonica	1512	86.20%	4.00%	0.20%	9.59%	NA
Aus	269	59.90%	35.30%	4.83%	0.00%	NA
Indica I	595	34.50%	11.40%	53.45%	0.67%	NA
Indica II	465	16.10%	46.20%	29.25%	8.17%	GCAC: 0.22%
Indica III	913	15.60%	47.30%	26.07%	10.95%	GCAC: 0.11%
Indica Intermediate	786	21.20%	39.80%	28.75%	10.18%	NA
Temperate Japonica	767	83.30%	0.90%	0.26%	15.51%	NA
Tropical Japonica	504	87.90%	9.70%	0.20%	2.18%	NA
Japonica Intermediate	241	91.70%	2.10%	0.00%	6.22%	NA
VI/Aromatic	96	77.10%	1.00%	3.12%	18.75%	NA
Intermediate	90	63.30%	13.30%	14.44%	8.89%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0707877145	G -> DEL	LOC_Os07g13728.1	N	frameshift_variant	Average:18.203; most accessible tissue: Minghui63 panicle, score: 29.741	N	N	N	N
vg0707877145	G -> A	LOC_Os07g13728.1	missense_variant ; p.Arg67His; MODERATE	nonsynonymous_codon ; R67H	Average:18.203; most accessible tissue: Minghui63 panicle, score: 29.741	unknown	unknown	TOLERATED	0.27
vg0707877145	G -> GCAC	LOC_Os07g13728.1	disruptive_inframe_insertion ; p.Thr68dup; MODERATE	inframe_variant	Average:18.203; most accessible tissue: Minghui63 panicle, score: 29.741	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0707877145	NA	1.77E-06	mr1076	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0707877145	NA	1.09E-06	mr1082	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0707877145	1.78E-06	3.80E-09	mr1085	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0707877145	NA	3.90E-08	mr1086	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0707877145	NA	3.56E-06	mr1088	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0707877145	NA	1.45E-08	mr1103	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0707877145	NA	7.68E-07	mr1104	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0707877145	NA	3.67E-10	mr1107	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0707877145	NA	5.01E-07	mr1139	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0707877145	NA	2.54E-07	mr1145	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0707877145	NA	1.81E-07	mr1204	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0707877145	NA	2.31E-10	mr1226	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0707877145	NA	2.21E-07	mr1246	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0707877145	NA	7.55E-07	mr1264	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0707877145	NA	5.93E-11	mr1281	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0707877145	NA	1.66E-07	mr1411	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0707877145	NA	4.99E-06	mr1436	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0707877145	NA	3.49E-08	mr1437	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0707877145	NA	8.01E-07	mr1542	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0707877145	NA	1.64E-07	mr1559	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0707877145	NA	7.99E-08	mr1560	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0707877145	NA	4.83E-06	mr1620	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0707877145	NA	1.34E-08	mr1770	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0707877145	NA	4.68E-06	mr1878	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0707877145	NA	2.84E-06	mr1949	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0707877145	NA	9.66E-06	mr1233_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0707877145	NA	2.17E-06	mr1246_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0707877145	NA	2.77E-07	mr1404_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0707877145	NA	9.06E-07	mr1559_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0707877145	NA	3.56E-06	mr1620_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0707877145	NA	4.88E-07	mr1819_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251