| Variant ID: vg0707584117 (JBrowse) | Variation Type: SNP |
| Chromosome: chr07 | Position: 7584117 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele: Not determined.
GGGCCATTTCTTCATCCGACAAAGTGATTTATAACATTATTCACAAAATGTACAAATCTCTTATATAGTTTATAAACTATAGGAGAGATATGTAAATTTT[A/G]
TAAACAATGTTACTATCACTTTGTCGGATGAAGAAATGACCAAAATAAAAGTTATAGATACTGATGAGTTATACAACTTTGATGTTGATGACCTTTTCAG
CTGAAAAGGTCATCAACATCAAAGTTGTATAACTCATCAGTATCTATAACTTTTATTTTGGTCATTTCTTCATCCGACAAAGTGATAGTAACATTGTTTA[T/C]
AAAATTTACATATCTCTCCTATAGTTTATAAACTATATAAGAGATTTGTACATTTTGTGAATAATGTTATAAATCACTTTGTCGGATGAAGAAATGGCCC
| Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 34.30% | 6.90% | 1.23% | 57.58% | NA |
| All Indica | 2759 | 5.50% | 0.90% | 1.92% | 91.66% | NA |
| All Japonica | 1512 | 79.00% | 16.50% | 0.00% | 4.50% | NA |
| Aus | 269 | 60.60% | 7.40% | 1.49% | 30.48% | NA |
| Indica I | 595 | 1.30% | 0.00% | 1.51% | 97.14% | NA |
| Indica II | 465 | 6.00% | 1.70% | 1.51% | 90.75% | NA |
| Indica III | 913 | 1.80% | 1.40% | 1.97% | 94.85% | NA |
| Indica Intermediate | 786 | 12.70% | 0.50% | 2.42% | 84.35% | NA |
| Temperate Japonica | 767 | 96.00% | 3.30% | 0.00% | 0.78% | NA |
| Tropical Japonica | 504 | 66.50% | 22.20% | 0.00% | 11.31% | NA |
| Japonica Intermediate | 241 | 51.50% | 46.50% | 0.00% | 2.07% | NA |
| VI/Aromatic | 96 | 76.00% | 21.90% | 0.00% | 2.08% | NA |
| Intermediate | 90 | 43.30% | 11.10% | 1.11% | 44.44% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0707584117 | A -> DEL | N | N | silent_mutation | Average:7.072; most accessible tissue: Callus, score: 17.01 | N | N | N | N |
| vg0707584117 | A -> G | LOC_Os07g13234.1 | upstream_gene_variant ; 353.0bp to feature; MODIFIER | silent_mutation | Average:7.072; most accessible tissue: Callus, score: 17.01 | N | N | N | N |
| vg0707584117 | A -> G | LOC_Os07g13234.2 | upstream_gene_variant ; 340.0bp to feature; MODIFIER | silent_mutation | Average:7.072; most accessible tissue: Callus, score: 17.01 | N | N | N | N |
| vg0707584117 | A -> G | LOC_Os07g13234-LOC_Os07g13240 | intergenic_region ; MODIFIER | silent_mutation | Average:7.072; most accessible tissue: Callus, score: 17.01 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0707584117 | 5.96E-07 | NA | Grain_width | All | YES | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
| vg0707584117 | NA | 3.08E-09 | mr1408 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0707584117 | NA | 9.48E-06 | mr1064_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |