\
| Variant ID: vg0707567583 (JBrowse) | Variation Type: SNP |
| Chromosome: chr07 | Position: 7567583 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.77, G: 0.23, others allele: 0.00, population size: 53. )
ACCTGAATAAAGCATGTCCGAAAGACGACTTCCCCTTGCCGCGAATCGACCAACTCTGGGGGCGAAGAGGGGCGCGAAGTATCGCTCGAACTCTTAGAAG[G/A]
AGTAAGGGTCGAAGCGCTCGAGCACATGCACAAGTACGCCACAAGCACTTCGGCAACTTACAACAAAAAAGTTCGACCCACGCAGCTGATGCCTGGTCAT
ATGACCAGGCATCAGCTGCGTGGGTCGAACTTTTTTGTTGTAAGTTGCCGAAGTGCTTGTGGCGTACTTGTGCATGTGCTCGAGCGCTTCGACCCTTACT[C/T]
CTTCTAAGAGTTCGAGCGATACTTCGCGCCCCTCTTCGCCCCCAGAGTTGGTCGATTCGCGGCAAGGGGAAGTCGTCTTTCGGACATGCTTTATTCAGGT
| Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 59.50% | 34.90% | 1.38% | 4.25% | NA |
| All Indica | 2759 | 93.30% | 6.20% | 0.25% | 0.25% | NA |
| All Japonica | 1512 | 5.30% | 79.70% | 2.45% | 12.57% | NA |
| Aus | 269 | 33.50% | 59.10% | 7.43% | 0.00% | NA |
| Indica I | 595 | 98.00% | 2.00% | 0.00% | 0.00% | NA |
| Indica II | 465 | 91.20% | 7.10% | 0.65% | 1.08% | NA |
| Indica III | 913 | 96.80% | 2.60% | 0.44% | 0.11% | NA |
| Indica Intermediate | 786 | 87.00% | 12.80% | 0.00% | 0.13% | NA |
| Temperate Japonica | 767 | 1.20% | 95.80% | 0.39% | 2.61% | NA |
| Tropical Japonica | 504 | 12.10% | 68.30% | 6.15% | 13.49% | NA |
| Japonica Intermediate | 241 | 4.10% | 52.30% | 1.24% | 42.32% | NA |
| VI/Aromatic | 96 | 24.00% | 76.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 47.80% | 46.70% | 1.11% | 4.44% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0707567583 | G -> DEL | LOC_Os07g13190.1 | N | frameshift_variant | Average:39.022; most accessible tissue: Minghui63 young leaf, score: 74.007 | N | N | N | N |
| vg0707567583 | G -> A | LOC_Os07g13190.1 | synonymous_variant ; p.Arg896Arg; LOW | synonymous_codon | Average:39.022; most accessible tissue: Minghui63 young leaf, score: 74.007 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0707567583 | NA | 1.17E-12 | mr1056 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0707567583 | NA | 5.51E-10 | mr1195 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0707567583 | NA | 6.81E-12 | mr1329 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0707567583 | NA | 6.48E-13 | mr1362 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0707567583 | NA | 2.12E-10 | mr1379 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0707567583 | NA | 1.10E-07 | mr1559 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0707567583 | NA | 2.92E-10 | mr1581 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0707567583 | NA | 3.28E-07 | mr1716 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0707567583 | NA | 6.55E-08 | mr1804 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0707567583 | NA | 9.80E-14 | mr1982 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0707567583 | NA | 5.79E-09 | mr1379_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0707567583 | NA | 5.38E-17 | mr1457_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0707567583 | 2.30E-06 | NA | mr1543_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0707567583 | NA | 2.19E-06 | mr1559_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0707567583 | NA | 7.53E-08 | mr1690_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |