\
| Variant ID: vg0707490731 (JBrowse) | Variation Type: SNP |
| Chromosome: chr07 | Position: 7490731 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: T | Secondary Allele: C |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.82, T: 0.18, others allele: 0.00, population size: 104. )
CAATTTTTAAAAGATTTAAATCACGCAGGTGGTAATTTCATATGTTAATTAGAGTTTTTAACAATTAATTTACTATCATTCATATGCTAATTATATATGA[T/C]
TATTCGAATTTTTAAAAGTTTTAAATCATGCATGTGGCATTTACATATGTTAATTAGAGTTTTTCACAATTTAATTTACTATCACTCATATGCTAATTAT
ATAATTAGCATATGAGTGATAGTAAATTAAATTGTGAAAAACTCTAATTAACATATGTAAATGCCACATGCATGATTTAAAACTTTTAAAAATTCGAATA[A/G]
TCATATATAATTAGCATATGAATGATAGTAAATTAATTGTTAAAAACTCTAATTAACATATGAAATTACCACCTGCGTGATTTAAATCTTTTAAAAATTG
| Populations | Population Size | Frequency of T(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 43.20% | 5.40% | 46.87% | 4.57% | NA |
| All Indica | 2759 | 20.30% | 6.00% | 72.42% | 1.30% | NA |
| All Japonica | 1512 | 79.70% | 0.50% | 8.27% | 11.57% | NA |
| Aus | 269 | 59.50% | 26.00% | 14.50% | 0.00% | NA |
| Indica I | 595 | 15.30% | 1.70% | 81.01% | 2.02% | NA |
| Indica II | 465 | 15.30% | 4.30% | 77.20% | 3.23% | NA |
| Indica III | 913 | 20.70% | 7.90% | 71.30% | 0.11% | NA |
| Indica Intermediate | 786 | 26.50% | 8.10% | 64.38% | 1.02% | NA |
| Temperate Japonica | 767 | 96.10% | 0.00% | 2.09% | 1.83% | NA |
| Tropical Japonica | 504 | 67.30% | 1.00% | 16.87% | 14.88% | NA |
| Japonica Intermediate | 241 | 53.50% | 0.80% | 9.96% | 35.68% | NA |
| VI/Aromatic | 96 | 77.10% | 4.20% | 18.75% | 0.00% | NA |
| Intermediate | 90 | 48.90% | 6.70% | 38.89% | 5.56% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0707490731 | T -> DEL | N | N | silent_mutation | Average:13.886; most accessible tissue: Minghui63 panicle, score: 34.226 | N | N | N | N |
| vg0707490731 | T -> C | LOC_Os07g13070.1 | upstream_gene_variant ; 2079.0bp to feature; MODIFIER | silent_mutation | Average:13.886; most accessible tissue: Minghui63 panicle, score: 34.226 | N | N | N | N |
| vg0707490731 | T -> C | LOC_Os07g13060.1 | downstream_gene_variant ; 245.0bp to feature; MODIFIER | silent_mutation | Average:13.886; most accessible tissue: Minghui63 panicle, score: 34.226 | N | N | N | N |
| vg0707490731 | T -> C | LOC_Os07g13060-LOC_Os07g13070 | intergenic_region ; MODIFIER | silent_mutation | Average:13.886; most accessible tissue: Minghui63 panicle, score: 34.226 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0707490731 | NA | 1.25E-06 | mr1058 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0707490731 | NA | 3.15E-10 | mr1195 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0707490731 | NA | 9.86E-13 | mr1329 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0707490731 | NA | 1.21E-09 | mr1379 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0707490731 | NA | 4.45E-25 | mr1416 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0707490731 | NA | 4.77E-10 | mr1524 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0707490731 | NA | 4.02E-11 | mr1581 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0707490731 | NA | 2.21E-14 | mr1592 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0707490731 | NA | 2.45E-08 | mr1804 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0707490731 | NA | 1.55E-13 | mr1982 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |