\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0707490731:

Variant ID: vg0707490731 (JBrowse)Variation Type: SNP
Chromosome: chr07Position: 7490731
Reference Allele: TAlternative Allele: C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.82, T: 0.18, others allele: 0.00, population size: 104. )

Flanking Sequence (100 bp) in Reference Genome:


CAATTTTTAAAAGATTTAAATCACGCAGGTGGTAATTTCATATGTTAATTAGAGTTTTTAACAATTAATTTACTATCATTCATATGCTAATTATATATGA[T/C]
TATTCGAATTTTTAAAAGTTTTAAATCATGCATGTGGCATTTACATATGTTAATTAGAGTTTTTCACAATTTAATTTACTATCACTCATATGCTAATTAT

Reverse complement sequence

ATAATTAGCATATGAGTGATAGTAAATTAAATTGTGAAAAACTCTAATTAACATATGTAAATGCCACATGCATGATTTAAAACTTTTAAAAATTCGAATA[A/G]
TCATATATAATTAGCATATGAATGATAGTAAATTAATTGTTAAAAACTCTAATTAACATATGAAATTACCACCTGCGTGATTTAAATCTTTTAAAAATTG

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 43.20% 5.40% 46.87% 4.57% NA
All Indica  2759 20.30% 6.00% 72.42% 1.30% NA
All Japonica  1512 79.70% 0.50% 8.27% 11.57% NA
Aus  269 59.50% 26.00% 14.50% 0.00% NA
Indica I  595 15.30% 1.70% 81.01% 2.02% NA
Indica II  465 15.30% 4.30% 77.20% 3.23% NA
Indica III  913 20.70% 7.90% 71.30% 0.11% NA
Indica Intermediate  786 26.50% 8.10% 64.38% 1.02% NA
Temperate Japonica  767 96.10% 0.00% 2.09% 1.83% NA
Tropical Japonica  504 67.30% 1.00% 16.87% 14.88% NA
Japonica Intermediate  241 53.50% 0.80% 9.96% 35.68% NA
VI/Aromatic  96 77.10% 4.20% 18.75% 0.00% NA
Intermediate  90 48.90% 6.70% 38.89% 5.56% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0707490731 T -> DEL N N silent_mutation Average:13.886; most accessible tissue: Minghui63 panicle, score: 34.226 N N N N
vg0707490731 T -> C LOC_Os07g13070.1 upstream_gene_variant ; 2079.0bp to feature; MODIFIER silent_mutation Average:13.886; most accessible tissue: Minghui63 panicle, score: 34.226 N N N N
vg0707490731 T -> C LOC_Os07g13060.1 downstream_gene_variant ; 245.0bp to feature; MODIFIER silent_mutation Average:13.886; most accessible tissue: Minghui63 panicle, score: 34.226 N N N N
vg0707490731 T -> C LOC_Os07g13060-LOC_Os07g13070 intergenic_region ; MODIFIER silent_mutation Average:13.886; most accessible tissue: Minghui63 panicle, score: 34.226 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0707490731 NA 1.25E-06 mr1058 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0707490731 NA 3.15E-10 mr1195 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0707490731 NA 9.86E-13 mr1329 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0707490731 NA 1.21E-09 mr1379 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0707490731 NA 4.45E-25 mr1416 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0707490731 NA 4.77E-10 mr1524 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0707490731 NA 4.02E-11 mr1581 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0707490731 NA 2.21E-14 mr1592 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0707490731 NA 2.45E-08 mr1804 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0707490731 NA 1.55E-13 mr1982 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251