Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0707469068:

Variant ID: vg0707469068 (JBrowse)	Variation Type: SNP
Chromosome: chr07	Position: 7469068
Reference Allele: G	Alternative Allele: C
Primary Allele: C	Secondary Allele: G

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.80, G: 0.20, others allele: 0.00, population size: 94. )

Flanking Sequence (100 bp) in Reference Genome:

GTAACATACAGTTTCAGTTTTGTTTTGGTGCACAAATGCAAGATACACTTATATATACAAACACTTTTGTGCTTGCTTGTGTTCTATGTACTACAGCTGA[G/C]
TTCTAAATTCTAAGACATGTTTAGCAAAATTGTGTGCTATGTGTTCTCTTATGTGGAGCTTAATTCCTGTACTAGATATGATAAATCCAATATCATAACA

Reverse complement sequence

TGTTATGATATTGGATTTATCATATCTAGTACAGGAATTAAGCTCCACATAAGAGAACACATAGCACACAATTTTGCTAAACATGTCTTAGAATTTAGAA[C/G]
TCAGCTGTAGTACATAGAACACAAGCAAGCACAAAAGTGTTTGTATATATAAGTGTATCTTGCATTTGTGCACCAAAACAAAACTGAAACTGTATGTTAC

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	58.70%	40.90%	0.32%	0.00%	NA
All Indica	2759	93.30%	6.20%	0.51%	0.00%	NA
All Japonica	1512	4.60%	95.30%	0.07%	0.00%	NA
Aus	269	33.50%	66.50%	0.00%	0.00%	NA
Indica I	595	97.30%	1.50%	1.18%	0.00%	NA
Indica II	465	91.00%	8.60%	0.43%	0.00%	NA
Indica III	913	98.10%	1.90%	0.00%	0.00%	NA
Indica Intermediate	786	86.00%	13.40%	0.64%	0.00%	NA
Temperate Japonica	767	0.90%	99.10%	0.00%	0.00%	NA
Tropical Japonica	504	11.30%	88.50%	0.20%	0.00%	NA
Japonica Intermediate	241	2.50%	97.50%	0.00%	0.00%	NA
VI/Aromatic	96	2.10%	97.90%	0.00%	0.00%	NA
Intermediate	90	44.40%	55.60%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0707469068	G -> C	LOC_Os07g13010.1	downstream_gene_variant ; 291.0bp to feature; MODIFIER	silent_mutation	Average:19.328; most accessible tissue: Callus, score: 28.082	N	N	N	N
vg0707469068	G -> C	LOC_Os07g13020.1	downstream_gene_variant ; 694.0bp to feature; MODIFIER	silent_mutation	Average:19.328; most accessible tissue: Callus, score: 28.082	N	N	N	N
vg0707469068	G -> C	LOC_Os07g13010-LOC_Os07g13020	intergenic_region ; MODIFIER	silent_mutation	Average:19.328; most accessible tissue: Callus, score: 28.082	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0707469068	NA	2.74E-25	mr1076	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0707469068	NA	4.77E-20	mr1131	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0707469068	NA	3.98E-10	mr1195	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0707469068	NA	2.03E-30	mr1225	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0707469068	NA	3.76E-07	mr1226	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0707469068	NA	2.36E-24	mr1264	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0707469068	NA	5.32E-16	mr1329	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0707469068	NA	1.79E-13	mr1362	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0707469068	NA	2.82E-11	mr1524	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0707469068	NA	1.57E-13	mr1592	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0707469068	NA	4.17E-07	mr1804	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0707469068	NA	2.27E-07	mr1836	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0707469068	NA	5.68E-14	mr1982	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0707469068	NA	2.88E-08	mr1690_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251