Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0707363448:

Variant ID: vg0707363448 (JBrowse)	Variation Type: SNP
Chromosome: chr07	Position: 7363448
Reference Allele: G	Alternative Allele: A
Primary Allele: A	Secondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

CCTGAGCTGCAGAATCATTCCCCGGTTCTGTTCACCTGCGCGCATAGGTGTACGGGACAAGCAGGTGCCTCCGGAACTCCGTCCGCTTGAGAACTTGCAC[G/A]
GGTAGGCGGGCGATCAAGTTTTTGGTAGCGCTTCAAGCGCGACTGCTCTTGTTCTTCGCGGCTACTGCTGCTGCATCGGCGCCTTCACCAAGATGTCAAC

Reverse complement sequence

GTTGACATCTTGGTGAAGGCGCCGATGCAGCAGCAGTAGCCGCGAAGAACAAGAGCAGTCGCGCTTGAAGCGCTACCAAAAACTTGATCGCCCGCCTACC[C/T]
GTGCAAGTTCTCAAGCGGACGGAGTTCCGGAGGCACCTGCTTGTCCCGTACACCTATGCGCGCAGGTGAACAGAACCGGGGAATGATTCTGCAGCTCAGG

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	53.20%	43.40%	3.41%	0.00%	NA
All Indica	2759	88.80%	9.20%	1.99%	0.00%	NA
All Japonica	1512	0.80%	98.30%	0.86%	0.00%	NA
Aus	269	5.90%	61.30%	32.71%	0.00%	NA
Indica I	595	96.00%	2.90%	1.18%	0.00%	NA
Indica II	465	85.80%	13.10%	1.08%	0.00%	NA
Indica III	913	93.50%	5.60%	0.88%	0.00%	NA
Indica Intermediate	786	79.50%	16.00%	4.45%	0.00%	NA
Temperate Japonica	767	0.90%	99.00%	0.13%	0.00%	NA
Tropical Japonica	504	0.20%	98.80%	0.99%	0.00%	NA
Japonica Intermediate	241	1.70%	95.40%	2.90%	0.00%	NA
VI/Aromatic	96	1.00%	97.90%	1.04%	0.00%	NA
Intermediate	90	38.90%	56.70%	4.44%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0707363448	G -> A	LOC_Os07g12850.1	upstream_gene_variant ; 93.0bp to feature; MODIFIER	silent_mutation	Average:21.524; most accessible tissue: Minghui63 panicle, score: 38.588	N	N	N	N
vg0707363448	G -> A	LOC_Os07g12840.1	downstream_gene_variant ; 1140.0bp to feature; MODIFIER	silent_mutation	Average:21.524; most accessible tissue: Minghui63 panicle, score: 38.588	N	N	N	N
vg0707363448	G -> A	LOC_Os07g12840-LOC_Os07g12850	intergenic_region ; MODIFIER	silent_mutation	Average:21.524; most accessible tissue: Minghui63 panicle, score: 38.588	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0707363448	NA	5.46E-27	mr1076	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0707363448	NA	2.12E-23	mr1083	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0707363448	NA	2.23E-30	mr1085	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0707363448	NA	6.64E-59	mr1088	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0707363448	NA	5.34E-06	mr1088	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0707363448	NA	8.45E-08	mr1103	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0707363448	NA	3.68E-47	mr1109	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0707363448	NA	1.06E-32	mr1129	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0707363448	NA	7.03E-22	mr1131	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0707363448	NA	1.42E-41	mr1139	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0707363448	NA	3.29E-28	mr1145	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0707363448	1.11E-06	NA	mr1178	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0707363448	NA	1.87E-15	mr1199	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0707363448	NA	8.38E-31	mr1204	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0707363448	NA	4.70E-33	mr1226	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0707363448	NA	2.36E-10	mr1226	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0707363448	NA	6.49E-32	mr1257	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0707363448	NA	1.05E-25	mr1264	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0707363448	NA	2.24E-28	mr1411	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0707363448	NA	2.21E-09	mr1411	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0707363448	NA	9.80E-29	mr1436	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0707363448	NA	7.13E-45	mr1437	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0707363448	NA	3.06E-08	mr1437	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0707363448	NA	3.95E-30	mr1560	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0707363448	NA	1.46E-07	mr1610	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0707363448	NA	8.65E-39	mr1620	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0707363448	NA	3.06E-11	mr1938	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0707363448	NA	1.35E-29	mr1932_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251