\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0707363448:

Variant ID: vg0707363448 (JBrowse)Variation Type: SNP
Chromosome: chr07Position: 7363448
Reference Allele: GAlternative Allele: A
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CCTGAGCTGCAGAATCATTCCCCGGTTCTGTTCACCTGCGCGCATAGGTGTACGGGACAAGCAGGTGCCTCCGGAACTCCGTCCGCTTGAGAACTTGCAC[G/A]
GGTAGGCGGGCGATCAAGTTTTTGGTAGCGCTTCAAGCGCGACTGCTCTTGTTCTTCGCGGCTACTGCTGCTGCATCGGCGCCTTCACCAAGATGTCAAC

Reverse complement sequence

GTTGACATCTTGGTGAAGGCGCCGATGCAGCAGCAGTAGCCGCGAAGAACAAGAGCAGTCGCGCTTGAAGCGCTACCAAAAACTTGATCGCCCGCCTACC[C/T]
GTGCAAGTTCTCAAGCGGACGGAGTTCCGGAGGCACCTGCTTGTCCCGTACACCTATGCGCGCAGGTGAACAGAACCGGGGAATGATTCTGCAGCTCAGG

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 53.20% 43.40% 3.41% 0.00% NA
All Indica  2759 88.80% 9.20% 1.99% 0.00% NA
All Japonica  1512 0.80% 98.30% 0.86% 0.00% NA
Aus  269 5.90% 61.30% 32.71% 0.00% NA
Indica I  595 96.00% 2.90% 1.18% 0.00% NA
Indica II  465 85.80% 13.10% 1.08% 0.00% NA
Indica III  913 93.50% 5.60% 0.88% 0.00% NA
Indica Intermediate  786 79.50% 16.00% 4.45% 0.00% NA
Temperate Japonica  767 0.90% 99.00% 0.13% 0.00% NA
Tropical Japonica  504 0.20% 98.80% 0.99% 0.00% NA
Japonica Intermediate  241 1.70% 95.40% 2.90% 0.00% NA
VI/Aromatic  96 1.00% 97.90% 1.04% 0.00% NA
Intermediate  90 38.90% 56.70% 4.44% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0707363448 G -> A LOC_Os07g12850.1 upstream_gene_variant ; 93.0bp to feature; MODIFIER silent_mutation Average:21.524; most accessible tissue: Minghui63 panicle, score: 38.588 N N N N
vg0707363448 G -> A LOC_Os07g12840.1 downstream_gene_variant ; 1140.0bp to feature; MODIFIER silent_mutation Average:21.524; most accessible tissue: Minghui63 panicle, score: 38.588 N N N N
vg0707363448 G -> A LOC_Os07g12840-LOC_Os07g12850 intergenic_region ; MODIFIER silent_mutation Average:21.524; most accessible tissue: Minghui63 panicle, score: 38.588 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0707363448 NA 5.46E-27 mr1076 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0707363448 NA 2.12E-23 mr1083 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0707363448 NA 2.23E-30 mr1085 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0707363448 NA 6.64E-59 mr1088 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0707363448 NA 5.34E-06 mr1088 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0707363448 NA 8.45E-08 mr1103 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0707363448 NA 3.68E-47 mr1109 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0707363448 NA 1.06E-32 mr1129 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0707363448 NA 7.03E-22 mr1131 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0707363448 NA 1.42E-41 mr1139 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0707363448 NA 3.29E-28 mr1145 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0707363448 1.11E-06 NA mr1178 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0707363448 NA 1.87E-15 mr1199 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0707363448 NA 8.38E-31 mr1204 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0707363448 NA 4.70E-33 mr1226 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0707363448 NA 2.36E-10 mr1226 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0707363448 NA 6.49E-32 mr1257 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0707363448 NA 1.05E-25 mr1264 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0707363448 NA 2.24E-28 mr1411 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0707363448 NA 2.21E-09 mr1411 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0707363448 NA 9.80E-29 mr1436 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0707363448 NA 7.13E-45 mr1437 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0707363448 NA 3.06E-08 mr1437 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0707363448 NA 3.95E-30 mr1560 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0707363448 NA 1.46E-07 mr1610 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0707363448 NA 8.65E-39 mr1620 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0707363448 NA 3.06E-11 mr1938 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0707363448 NA 1.35E-29 mr1932_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251