\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0707361067:

Variant ID: vg0707361067 (JBrowse)Variation Type: SNP
Chromosome: chr07Position: 7361067
Reference Allele: TAlternative Allele: G,A
Primary Allele: GSecondary Allele: T

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.83, T: 0.17, others allele: 0.00, population size: 90. )

Flanking Sequence (100 bp) in Reference Genome:


CTTGTGGCCAAGGGTTATACCCAAAAGAAGGCGAGGATTTTTTTTCGACACTTATTCACCTGTTGCTCGCTTGACCACGATTCGAGTCCTACTCGCTCTG[T/G,A]
CAGCCTCTCATGGTCTACTCGTCCATCAGATGGATGTTAAGACAGCTTTCCTCAATGGAGAGTTGGAGGAGGAGATCTATATGGATCAACCAGATGGGTA

Reverse complement sequence

TACCCATCTGGTTGATCCATATAGATCTCCTCCTCCAACTCTCCATTGAGGAAAGCTGTCTTAACATCCATCTGATGGACGAGTAGACCATGAGAGGCTG[A/C,T]
CAGAGCGAGTAGGACTCGAATCGTGGTCAAGCGAGCAACAGGTGAATAAGTGTCGAAAAAAAATCCTCGCCTTCTTTTGGGTATAACCCTTGGCCACAAG

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 57.80% 34.20% 6.35% 1.57% A: 0.02%
All Indica  2759 92.60% 5.30% 1.85% 0.18% NA
All Japonica  1512 6.40% 79.20% 9.99% 4.37% NA
Aus  269 6.70% 59.90% 33.46% 0.00% NA
Indica I  595 97.00% 2.70% 0.34% 0.00% NA
Indica II  465 92.00% 6.20% 0.65% 1.08% NA
Indica III  913 98.50% 0.80% 0.77% 0.00% NA
Indica Intermediate  786 83.00% 12.10% 4.96% 0.00% NA
Temperate Japonica  767 1.30% 96.00% 1.56% 1.17% NA
Tropical Japonica  504 13.10% 67.10% 15.48% 4.37% NA
Japonica Intermediate  241 8.70% 51.50% 25.31% 14.52% NA
VI/Aromatic  96 22.90% 76.00% 1.04% 0.00% NA
Intermediate  90 44.40% 43.30% 7.78% 3.33% A: 1.11%

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0707361067 T -> DEL N N silent_mutation Average:25.273; most accessible tissue: Callus, score: 41.326 N N N N
vg0707361067 T -> G LOC_Os07g12850.1 upstream_gene_variant ; 2474.0bp to feature; MODIFIER silent_mutation Average:25.273; most accessible tissue: Callus, score: 41.326 N N N N
vg0707361067 T -> G LOC_Os07g12840.1 intron_variant ; MODIFIER silent_mutation Average:25.273; most accessible tissue: Callus, score: 41.326 N N N N
vg0707361067 T -> A LOC_Os07g12850.1 upstream_gene_variant ; 2474.0bp to feature; MODIFIER silent_mutation Average:25.273; most accessible tissue: Callus, score: 41.326 N N N N
vg0707361067 T -> A LOC_Os07g12840.1 intron_variant ; MODIFIER silent_mutation Average:25.273; most accessible tissue: Callus, score: 41.326 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0707361067 NA 6.44E-14 mr1031 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0707361067 NA 4.17E-26 mr1037 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0707361067 NA 8.92E-15 mr1056 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0707361067 NA 2.23E-06 mr1058 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0707361067 NA 5.65E-12 mr1329 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0707361067 NA 7.96E-14 mr1362 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0707361067 NA 1.26E-10 mr1379 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0707361067 NA 3.22E-22 mr1416 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0707361067 NA 4.08E-08 mr1559 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0707361067 NA 3.00E-07 mr1804 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0707361067 NA 3.04E-08 mr1836 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0707361067 NA 1.40E-12 mr1147_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0707361067 NA 4.42E-17 mr1457_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0707361067 7.09E-07 NA mr1486_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0707361067 NA 2.53E-06 mr1559_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251