\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0707341833:

Variant ID: vg0707341833 (JBrowse)Variation Type: SNP
Chromosome: chr07Position: 7341833
Reference Allele: AAlternative Allele: G
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.83, A: 0.17, others allele: 0.00, population size: 59. )

Flanking Sequence (100 bp) in Reference Genome:


CCAGATTGTTTGCTCCGCAAAAGGAGATGGAACCCTAAAGTACTGAATTGCTTGATCGATTGATCCAGAACGGGACAATATATATGCCTTTCCGCGTGAT[A/G]
CTTCTTCCACCTGCAGTAAATTTGGGCATCATAATCATAATTTACACACAGAAACCAACAAATAAAATGTCAAGTAAATTTCCACGGGCACATTACATTC

Reverse complement sequence

GAATGTAATGTGCCCGTGGAAATTTACTTGACATTTTATTTGTTGGTTTCTGTGTGTAAATTATGATTATGATGCCCAAATTTACTGCAGGTGGAAGAAG[T/C]
ATCACGCGGAAAGGCATATATATTGTCCCGTTCTGGATCAATCGATCAAGCAATTCAGTACTTTAGGGTTCCATCTCCTTTTGCGGAGCAAACAATCTGG

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 25.40% 15.00% 0.72% 58.84% NA
All Indica  2759 5.10% 6.50% 0.91% 87.50% NA
All Japonica  1512 63.40% 16.10% 0.33% 20.17% NA
Aus  269 1.50% 92.90% 0.37% 5.20% NA
Indica I  595 2.90% 0.70% 2.18% 94.29% NA
Indica II  465 6.00% 4.70% 1.29% 87.96% NA
Indica III  913 0.70% 7.80% 0.22% 91.35% NA
Indica Intermediate  786 11.50% 10.40% 0.51% 77.61% NA
Temperate Japonica  767 95.70% 0.30% 0.39% 3.65% NA
Tropical Japonica  504 22.00% 45.40% 0.40% 32.14% NA
Japonica Intermediate  241 46.90% 5.40% 0.00% 47.72% NA
VI/Aromatic  96 70.80% 16.70% 1.04% 11.46% NA
Intermediate  90 32.20% 24.40% 2.22% 41.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0707341833 A -> DEL N N silent_mutation Average:28.337; most accessible tissue: Callus, score: 48.203 N N N N
vg0707341833 A -> G LOC_Os07g12820-LOC_Os07g12830 intergenic_region ; MODIFIER silent_mutation Average:28.337; most accessible tissue: Callus, score: 48.203 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0707341833 NA 3.01E-06 mr1058 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0707341833 NA 6.71E-06 mr1125 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0707341833 NA 1.27E-07 mr1345 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0707341833 NA 3.08E-07 mr1382 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0707341833 NA 1.42E-07 mr1448 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0707341833 NA 1.41E-08 mr1530 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0707341833 NA 2.25E-16 mr1696 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0707341833 NA 3.28E-07 mr1706 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0707341833 NA 1.47E-06 mr1735 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0707341833 NA 2.09E-11 mr1047_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0707341833 NA 3.88E-07 mr1047_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0707341833 NA 5.80E-11 mr1125_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0707341833 NA 3.80E-23 mr1530_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0707341833 NA 1.84E-09 mr1642_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0707341833 NA 2.59E-09 mr1642_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0707341833 NA 2.32E-07 mr1798_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0707341833 NA 2.43E-08 mr1808_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0707341833 NA 5.25E-08 mr1808_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0707341833 NA 2.37E-06 mr1815_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0707341833 NA 1.51E-06 mr1966_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251