\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0707315648:

Variant ID: vg0707315648 (JBrowse)Variation Type: SNP
Chromosome: chr07Position: 7315648
Reference Allele: CAlternative Allele: A
Primary Allele: ASecondary Allele: C

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.97, C: 0.03, others allele: 0.00, population size: 116. )

Flanking Sequence (100 bp) in Reference Genome:


TATTTGGATATTTTTTAAGTAGTTAGTTATATAATTAAATTAATTTCTAATTAAAGTAAGTGTGAGAAATAAAATGTTATGGTTGGATTTAATGTTTATT[C/A]
AATTTTCTATATTATTAATTACACTCATTGAAATTTTCGTAGCTTAATTGCTAATTTTGATAATACAAACATCATTTTAGCATTTATTTAAATAAAAATC

Reverse complement sequence

GATTTTTATTTAAATAAATGCTAAAATGATGTTTGTATTATCAAAATTAGCAATTAAGCTACGAAAATTTCAATGAGTGTAATTAATAATATAGAAAATT[G/T]
AATAAACATTAAATCCAACCATAACATTTTATTTCTCACACTTACTTTAATTAGAAATTAATTTAATTATATAACTAACTACTTAAAAAATATCCAAATA

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 74.90% 24.80% 0.23% 0.00% NA
All Indica  2759 95.30% 4.60% 0.11% 0.00% NA
All Japonica  1512 36.70% 62.90% 0.40% 0.00% NA
Aus  269 99.30% 0.40% 0.37% 0.00% NA
Indica I  595 98.70% 1.30% 0.00% 0.00% NA
Indica II  465 93.50% 6.50% 0.00% 0.00% NA
Indica III  913 99.50% 0.50% 0.00% 0.00% NA
Indica Intermediate  786 89.10% 10.60% 0.38% 0.00% NA
Temperate Japonica  767 4.70% 95.20% 0.13% 0.00% NA
Tropical Japonica  504 77.40% 21.80% 0.79% 0.00% NA
Japonica Intermediate  241 53.50% 46.10% 0.41% 0.00% NA
VI/Aromatic  96 27.10% 71.90% 1.04% 0.00% NA
Intermediate  90 70.00% 30.00% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0707315648 C -> A LOC_Os07g12790.1 upstream_gene_variant ; 1402.0bp to feature; MODIFIER silent_mutation Average:62.475; most accessible tissue: Zhenshan97 flower, score: 88.827 N N N N
vg0707315648 C -> A LOC_Os07g12770.1 downstream_gene_variant ; 2570.0bp to feature; MODIFIER silent_mutation Average:62.475; most accessible tissue: Zhenshan97 flower, score: 88.827 N N N N
vg0707315648 C -> A LOC_Os07g12780.1 downstream_gene_variant ; 901.0bp to feature; MODIFIER silent_mutation Average:62.475; most accessible tissue: Zhenshan97 flower, score: 88.827 N N N N
vg0707315648 C -> A LOC_Os07g12780-LOC_Os07g12790 intergenic_region ; MODIFIER silent_mutation Average:62.475; most accessible tissue: Zhenshan97 flower, score: 88.827 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0707315648 NA 3.84E-07 mr1047_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0707315648 6.17E-07 NA mr1064_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0707315648 NA 1.73E-07 mr1064_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0707315648 NA 5.49E-11 mr1543_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0707315648 NA 7.38E-07 mr1680_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0707315648 NA 1.23E-06 mr1727_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0707315648 NA 5.13E-06 mr1840_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251