\
| Variant ID: vg0707315648 (JBrowse) | Variation Type: SNP |
| Chromosome: chr07 | Position: 7315648 |
| Reference Allele: C | Alternative Allele: A |
| Primary Allele: A | Secondary Allele: C |
Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.97, C: 0.03, others allele: 0.00, population size: 116. )
TATTTGGATATTTTTTAAGTAGTTAGTTATATAATTAAATTAATTTCTAATTAAAGTAAGTGTGAGAAATAAAATGTTATGGTTGGATTTAATGTTTATT[C/A]
AATTTTCTATATTATTAATTACACTCATTGAAATTTTCGTAGCTTAATTGCTAATTTTGATAATACAAACATCATTTTAGCATTTATTTAAATAAAAATC
GATTTTTATTTAAATAAATGCTAAAATGATGTTTGTATTATCAAAATTAGCAATTAAGCTACGAAAATTTCAATGAGTGTAATTAATAATATAGAAAATT[G/T]
AATAAACATTAAATCCAACCATAACATTTTATTTCTCACACTTACTTTAATTAGAAATTAATTTAATTATATAACTAACTACTTAAAAAATATCCAAATA
| Populations | Population Size | Frequency of A(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 74.90% | 24.80% | 0.23% | 0.00% | NA |
| All Indica | 2759 | 95.30% | 4.60% | 0.11% | 0.00% | NA |
| All Japonica | 1512 | 36.70% | 62.90% | 0.40% | 0.00% | NA |
| Aus | 269 | 99.30% | 0.40% | 0.37% | 0.00% | NA |
| Indica I | 595 | 98.70% | 1.30% | 0.00% | 0.00% | NA |
| Indica II | 465 | 93.50% | 6.50% | 0.00% | 0.00% | NA |
| Indica III | 913 | 99.50% | 0.50% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 89.10% | 10.60% | 0.38% | 0.00% | NA |
| Temperate Japonica | 767 | 4.70% | 95.20% | 0.13% | 0.00% | NA |
| Tropical Japonica | 504 | 77.40% | 21.80% | 0.79% | 0.00% | NA |
| Japonica Intermediate | 241 | 53.50% | 46.10% | 0.41% | 0.00% | NA |
| VI/Aromatic | 96 | 27.10% | 71.90% | 1.04% | 0.00% | NA |
| Intermediate | 90 | 70.00% | 30.00% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0707315648 | C -> A | LOC_Os07g12790.1 | upstream_gene_variant ; 1402.0bp to feature; MODIFIER | silent_mutation | Average:62.475; most accessible tissue: Zhenshan97 flower, score: 88.827 | N | N | N | N |
| vg0707315648 | C -> A | LOC_Os07g12770.1 | downstream_gene_variant ; 2570.0bp to feature; MODIFIER | silent_mutation | Average:62.475; most accessible tissue: Zhenshan97 flower, score: 88.827 | N | N | N | N |
| vg0707315648 | C -> A | LOC_Os07g12780.1 | downstream_gene_variant ; 901.0bp to feature; MODIFIER | silent_mutation | Average:62.475; most accessible tissue: Zhenshan97 flower, score: 88.827 | N | N | N | N |
| vg0707315648 | C -> A | LOC_Os07g12780-LOC_Os07g12790 | intergenic_region ; MODIFIER | silent_mutation | Average:62.475; most accessible tissue: Zhenshan97 flower, score: 88.827 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0707315648 | NA | 3.84E-07 | mr1047_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0707315648 | 6.17E-07 | NA | mr1064_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0707315648 | NA | 1.73E-07 | mr1064_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0707315648 | NA | 5.49E-11 | mr1543_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0707315648 | NA | 7.38E-07 | mr1680_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0707315648 | NA | 1.23E-06 | mr1727_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0707315648 | NA | 5.13E-06 | mr1840_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |