\
| Variant ID: vg0707270813 (JBrowse) | Variation Type: SNP |
| Chromosome: chr07 | Position: 7270813 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele: Not determined.
AATGTTATTCTGGATGGCATAATAAATGTGCACCTCTGATAGCTCCTCACATCTAATCATATCCATCATTGTGCTCACCTATGTTATATTTAGTGGTGGA[A/G]
ATTTAAAGTTTCAGGTTGGATATATCCCTTTCCAGAGTTCAGATCTTGCATGGGCGACAGGTATCATTATAATGATGAGTTCAGGTTGTTTATTTTGCAG
CTGCAAAATAAACAACCTGAACTCATCATTATAATGATACCTGTCGCCCATGCAAGATCTGAACTCTGGAAAGGGATATATCCAACCTGAAACTTTAAAT[T/C]
TCCACCACTAAATATAACATAGGTGAGCACAATGATGGATATGATTAGATGTGAGGAGCTATCAGAGGTGCACATTTATTATGCCATCCAGAATAACATT
| Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 94.20% | 5.00% | 0.76% | 0.00% | NA |
| All Indica | 2759 | 99.70% | 0.10% | 0.14% | 0.00% | NA |
| All Japonica | 1512 | 82.80% | 15.10% | 2.05% | 0.00% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica II | 465 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| Indica III | 913 | 99.90% | 0.10% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 99.40% | 0.10% | 0.51% | 0.00% | NA |
| Temperate Japonica | 767 | 79.50% | 17.70% | 2.74% | 0.00% | NA |
| Tropical Japonica | 504 | 94.20% | 5.00% | 0.79% | 0.00% | NA |
| Japonica Intermediate | 241 | 69.30% | 28.20% | 2.49% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 94.40% | 4.40% | 1.11% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0707270813 | A -> G | LOC_Os07g12720.1 | downstream_gene_variant ; 1421.0bp to feature; MODIFIER | silent_mutation | Average:57.081; most accessible tissue: Callus, score: 82.71 | N | N | N | N |
| vg0707270813 | A -> G | LOC_Os07g12730.1 | downstream_gene_variant ; 2043.0bp to feature; MODIFIER | silent_mutation | Average:57.081; most accessible tissue: Callus, score: 82.71 | N | N | N | N |
| vg0707270813 | A -> G | LOC_Os07g12720-LOC_Os07g12730 | intergenic_region ; MODIFIER | silent_mutation | Average:57.081; most accessible tissue: Callus, score: 82.71 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0707270813 | NA | 1.02E-07 | mr1097 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0707270813 | 5.84E-07 | 5.84E-07 | mr1128 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0707270813 | NA | 7.08E-06 | mr1092_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |