\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0707252342:

Variant ID: vg0707252342 (JBrowse)Variation Type: SNP
Chromosome: chr07Position: 7252342
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


ATCCAAAGCTTCTTCAGGTTTCATCTCAAATTTAATATACTCCTTTTTGAAAAGATCTCGACGAAGCTCTTTAATGTTATTTGTTCCTTGATGAAAATTA[C/T]
TCAAAGCAACCCAAATCTCATGAGCAGTTTGAAGATGAGCAATACGATCATAATCCGAACGAGAAATACCACTCAAAAGAATGTTACGAGCTTTGCAATT

Reverse complement sequence

AATTGCAAAGCTCGTAACATTCTTTTGAGTGGTATTTCTCGTTCGGATTATGATCGTATTGCTCATCTTCAAACTGCTCATGAGATTTGGGTTGCTTTGA[G/A]
TAATTTTCATCAAGGAACAAATAACATTAAAGAGCTTCGTCGAGATCTTTTCAAAAAGGAGTATATTAAATTTGAGATGAAACCTGAAGAAGCTTTGGAT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 99.00% 0.40% 0.11% 0.44% NA
All Indica  2759 98.80% 0.70% 0.18% 0.36% NA
All Japonica  1512 99.30% 0.00% 0.00% 0.73% NA
Aus  269 99.60% 0.40% 0.00% 0.00% NA
Indica I  595 100.00% 0.00% 0.00% 0.00% NA
Indica II  465 99.10% 0.60% 0.22% 0.00% NA
Indica III  913 98.10% 0.90% 0.33% 0.66% NA
Indica Intermediate  786 98.30% 1.00% 0.13% 0.51% NA
Temperate Japonica  767 100.00% 0.00% 0.00% 0.00% NA
Tropical Japonica  504 98.00% 0.00% 0.00% 1.98% NA
Japonica Intermediate  241 99.60% 0.00% 0.00% 0.41% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 98.90% 1.10% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0707252342 C -> DEL LOC_Os07g12690.1 N frameshift_variant Average:4.881; most accessible tissue: Minghui63 panicle, score: 7.125 N N N N
vg0707252342 C -> T LOC_Os07g12690.1 missense_variant ; p.Ser96Asn; MODERATE nonsynonymous_codon ; S96N Average:4.881; most accessible tissue: Minghui63 panicle, score: 7.125 benign 0.481 TOLERATED 0.17

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0707252342 3.53E-06 NA mr1008 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0707252342 7.74E-06 NA mr1009 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0707252342 5.17E-06 NA mr1489 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0707252342 9.80E-08 8.55E-06 mr1536 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0707252342 1.79E-06 1.79E-06 mr1778 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251