Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0707116055:

Variant ID: vg0707116055 (JBrowse)Variation Type: SNP
Chromosome: chr07Position: 7116055
Reference Allele: CAlternative Allele: T
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.64, T: 0.35, others allele: 0.00, population size: 209. )

Flanking Sequence (100 bp) in Reference Genome:


AAATTTGTCCAATCATGTTCTGACAGTCCTTTTCCAATTTTTCTTTTGCATAGACCAAGAAATTGATGACAGCAGTAAAATAAGGTCATATATTACCAAA[C/T]
AGGAATATTCCCGTACGAATCTAGACATACCTCTGTCTAAATTCGTTGGTCTAGAGAATGTGTCATCCAGTCCTGGATTTGTTTTTTGTTTTTTTTGACG

Reverse complement sequence

CGTCAAAAAAAACAAAAAACAAATCCAGGACTGGATGACACATTCTCTAGACCAACGAATTTAGACAGAGGTATGTCTAGATTCGTACGGGAATATTCCT[G/A]
TTTGGTAATATATGACCTTATTTTACTGCTGTCATCAATTTCTTGGTCTATGCAAAAGAAAAATTGGAAAAGGACTGTCAGAACATGATTGGACAAATTT

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 57.80% 42.00% 0.25% 0.00% NA
All Indica  2759 93.90% 6.00% 0.07% 0.00% NA
All Japonica  1512 0.50% 99.50% 0.00% 0.00% NA
Aus  269 33.50% 63.20% 3.35% 0.00% NA
Indica I  595 98.80% 1.20% 0.00% 0.00% NA
Indica II  465 92.30% 7.70% 0.00% 0.00% NA
Indica III  913 95.60% 4.40% 0.00% 0.00% NA
Indica Intermediate  786 89.30% 10.40% 0.25% 0.00% NA
Temperate Japonica  767 0.50% 99.50% 0.00% 0.00% NA
Tropical Japonica  504 0.40% 99.60% 0.00% 0.00% NA
Japonica Intermediate  241 0.80% 99.20% 0.00% 0.00% NA
VI/Aromatic  96 2.10% 97.90% 0.00% 0.00% NA
Intermediate  90 42.20% 56.70% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0707116055 C -> T LOC_Os07g12480.1 upstream_gene_variant ; 3316.0bp to feature; MODIFIER silent_mutation Average:55.873; most accessible tissue: Zhenshan97 root, score: 93.154 N N N N
vg0707116055 C -> T LOC_Os07g12490.1 upstream_gene_variant ; 4664.0bp to feature; MODIFIER silent_mutation Average:55.873; most accessible tissue: Zhenshan97 root, score: 93.154 N N N N
vg0707116055 C -> T LOC_Os07g12490.2 upstream_gene_variant ; 4899.0bp to feature; MODIFIER silent_mutation Average:55.873; most accessible tissue: Zhenshan97 root, score: 93.154 N N N N
vg0707116055 C -> T LOC_Os07g12480-LOC_Os07g12490 intergenic_region ; MODIFIER silent_mutation Average:55.873; most accessible tissue: Zhenshan97 root, score: 93.154 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0707116055 C T -0.01 -0.03 -0.03 -0.02 -0.02 0.0

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0707116055 NA 1.70E-26 mr1076 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0707116055 NA 4.45E-32 mr1085 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0707116055 NA 2.14E-58 mr1088 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0707116055 NA 4.54E-56 mr1103 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0707116055 NA 9.45E-30 mr1107 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0707116055 NA 5.54E-40 mr1139 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0707116055 NA 5.56E-28 mr1145 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0707116055 NA 2.07E-10 mr1195 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0707116055 NA 9.84E-30 mr1204 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0707116055 NA 7.49E-29 mr1226 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0707116055 NA 1.41E-24 mr1264 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0707116055 NA 6.37E-29 mr1436 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0707116055 NA 2.20E-40 mr1437 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0707116055 NA 1.81E-41 mr1509 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0707116055 NA 9.89E-47 mr1558 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0707116055 NA 4.27E-11 mr1609 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0707116055 NA 3.74E-40 mr1620 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0707116055 NA 4.17E-11 mr1657 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0707116055 NA 4.27E-64 mr1671 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0707116055 NA 4.59E-12 mr1744 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0707116055 NA 6.20E-30 mr1793 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0707116055 NA 2.63E-48 mr1798 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0707116055 NA 1.39E-55 mr1067_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0707116055 NA 1.34E-45 mr1070_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0707116055 NA 1.80E-34 mr1083_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0707116055 NA 3.13E-79 mr1088_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0707116055 NA 6.44E-67 mr1103_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0707116055 NA 9.17E-37 mr1104_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0707116055 NA 3.13E-43 mr1145_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0707116055 NA 5.14E-35 mr1181_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0707116055 NA 1.54E-54 mr1200_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0707116055 NA 8.93E-39 mr1264_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0707116055 NA 3.10E-23 mr1316_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0707116055 NA 8.01E-09 mr1322_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0707116055 NA 4.47E-13 mr1325_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0707116055 NA 9.07E-15 mr1326_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0707116055 NA 1.03E-19 mr1362_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0707116055 NA 2.09E-52 mr1404_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0707116055 NA 8.02E-45 mr1437_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0707116055 NA 1.57E-45 mr1509_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0707116055 NA 2.04E-21 mr1551_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0707116055 NA 6.43E-23 mr1609_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0707116055 NA 4.45E-48 mr1620_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0707116055 NA 5.44E-89 mr1671_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0707116055 NA 7.93E-16 mr1836_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0707116055 NA 8.15E-36 mr1878_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251