\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0707113245:

Variant ID: vg0707113245 (JBrowse)Variation Type: SNP
Chromosome: chr07Position: 7113245
Reference Allele: AAlternative Allele: T
Primary Allele: ASecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GTGAAGGGTAAAATATCTTTATGCCATGGAAGGAACCAAAATTATAGCTCACCTCTAAGATCAACTACAGAGTACCTCCGTTCTAAGGCCCTCTTTTTTT[A/T]
GGCTTATTGGCCTAAACTTTTAAATTAGCTTATTGGCTTATATGATTTATAAGCCGGTGGATTTAATATCCTAAGTTTAGTGGTTGAGTCATACATCTAC

Reverse complement sequence

GTAGATGTATGACTCAACCACTAAACTTAGGATATTAAATCCACCGGCTTATAAATCATATAAGCCAATAAGCTAATTTAAAAGTTTAGGCCAATAAGCC[T/A]
AAAAAAAGAGGGCCTTAGAACGGAGGTACTCTGTAGTTGATCTTAGAGGTGAGCTATAATTTTGGTTCCTTCCATGGCATAAAGATATTTTACCCTTCAC

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 55.20% 3.80% 7.47% 33.52% NA
All Indica  2759 37.90% 0.10% 7.68% 54.30% NA
All Japonica  1512 89.10% 6.30% 4.10% 0.46% NA
Aus  269 60.20% 0.00% 18.59% 21.19% NA
Indica I  595 76.80% 0.00% 2.35% 20.84% NA
Indica II  465 26.90% 0.00% 5.16% 67.96% NA
Indica III  913 12.40% 0.10% 11.06% 76.45% NA
Indica Intermediate  786 44.50% 0.40% 9.29% 45.80% NA
Temperate Japonica  767 91.30% 4.30% 3.91% 0.52% NA
Tropical Japonica  504 86.90% 8.10% 4.76% 0.20% NA
Japonica Intermediate  241 86.70% 9.10% 3.32% 0.83% NA
VI/Aromatic  96 2.10% 74.00% 22.92% 1.04% NA
Intermediate  90 58.90% 10.00% 7.78% 23.33% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0707113245 A -> DEL N N silent_mutation Average:84.349; most accessible tissue: Minghui63 panicle, score: 89.702 N N N N
vg0707113245 A -> T LOC_Os07g12480.1 upstream_gene_variant ; 506.0bp to feature; MODIFIER silent_mutation Average:84.349; most accessible tissue: Minghui63 panicle, score: 89.702 N N N N
vg0707113245 A -> T LOC_Os07g12470.1 downstream_gene_variant ; 3103.0bp to feature; MODIFIER silent_mutation Average:84.349; most accessible tissue: Minghui63 panicle, score: 89.702 N N N N
vg0707113245 A -> T LOC_Os07g12480-LOC_Os07g12490 intergenic_region ; MODIFIER silent_mutation Average:84.349; most accessible tissue: Minghui63 panicle, score: 89.702 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0707113245 A T -0.03 -0.01 0.0 -0.01 -0.01 -0.01

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0707113245 NA 6.63E-06 mr1247 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0707113245 3.21E-06 2.66E-06 mr1968 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0707113245 5.56E-06 2.75E-06 mr1008_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0707113245 NA 1.21E-06 mr1114_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0707113245 NA 7.54E-06 mr1117_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0707113245 NA 3.88E-06 mr1119_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0707113245 NA 3.35E-06 mr1240_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0707113245 NA 8.26E-06 mr1242_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0707113245 NA 2.59E-06 mr1961_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251