Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0707077541:

Variant ID: vg0707077541 (JBrowse)	Variation Type: SNP
Chromosome: chr07	Position: 7077541
Reference Allele: A	Alternative Allele: G
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 108. )

Flanking Sequence (100 bp) in Reference Genome:

CCAAATTTGGTATGTTTGGTTATGTAAAGTTTCTTTCTTGTACTAGAGGGTTTCCTAAGGTGTTTAGGACTCCTAGTATGAGTTTGGTTCATGGCTTTAG[A/G]
CTGCCTACCTCATGTATAAATAGAGGGGGAGCGTGAGGCTTCCCGGTATCGCTTTTCAGAGCAATAGAGTTGAGTTTTGAGTTAGGGTTTTGAGTTTAGT

Reverse complement sequence

ACTAAACTCAAAACCCTAACTCAAAACTCAACTCTATTGCTCTGAAAAGCGATACCGGGAAGCCTCACGCTCCCCCTCTATTTATACATGAGGTAGGCAG[T/C]
CTAAAGCCATGAACCAAACTCATACTAGGAGTCCTAAACACCTTAGGAAACCCTCTAGTACAAGAAAGAAACTTTACATAACCAAACATACCAAATTTGG

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	63.70%	35.30%	1.04%	0.00%	NA
All Indica	2759	94.10%	4.20%	1.70%	0.00%	NA
All Japonica	1512	16.10%	83.90%	0.07%	0.00%	NA
Aus	269	42.00%	58.00%	0.00%	0.00%	NA
Indica I	595	97.60%	1.20%	1.18%	0.00%	NA
Indica II	465	90.30%	8.00%	1.72%	0.00%	NA
Indica III	913	96.60%	2.40%	0.99%	0.00%	NA
Indica Intermediate	786	90.60%	6.50%	2.93%	0.00%	NA
Temperate Japonica	767	4.60%	95.30%	0.13%	0.00%	NA
Tropical Japonica	504	20.20%	79.80%	0.00%	0.00%	NA
Japonica Intermediate	241	44.00%	56.00%	0.00%	0.00%	NA
VI/Aromatic	96	14.60%	85.40%	0.00%	0.00%	NA
Intermediate	90	50.00%	48.90%	1.11%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0707077541	A -> G	LOC_Os07g12410.1	upstream_gene_variant ; 527.0bp to feature; MODIFIER	silent_mutation	Average:22.17; most accessible tissue: Zhenshan97 flag leaf, score: 37.1	N	N	N	N
vg0707077541	A -> G	LOC_Os07g12400-LOC_Os07g12410	intergenic_region ; MODIFIER	silent_mutation	Average:22.17; most accessible tissue: Zhenshan97 flag leaf, score: 37.1	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0707077541	NA	5.26E-12	mr1169	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0707077541	NA	1.80E-07	mr1836	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0707077541	2.23E-07	4.31E-12	mr1033_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0707077541	NA	2.40E-06	mr1053_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0707077541	NA	2.43E-13	mr1147_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0707077541	NA	1.23E-17	mr1199_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0707077541	NA	5.07E-09	mr1379_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0707077541	NA	3.21E-13	mr1713_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0707077541	NA	1.26E-06	mr1727_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0707077541	NA	8.81E-06	mr1840_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251