\
| Variant ID: vg0707066814 (JBrowse) | Variation Type: SNP |
| Chromosome: chr07 | Position: 7066814 |
| Reference Allele: A | Alternative Allele: T |
| Primary Allele: T | Secondary Allele: A |
Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 1.01, others allele: 0.00, population size: 272. )
CGCTAGATGAAGGCTTTAGGTTACATTGTTCAACGAGAGTAGGAGGTGGTGGAGGTGACCTGATATGAATAGTGGTGAGAAAGCTCAATTTGATTGTCAA[A/T]
TGTGGTATGTGGAGTAAGCAAAATAGAGGTTGGTTGTGCAACCGCGATCATTTTGGCTCAACCGCCAACCAAATGCAACAGTAACATTTGTGTCGATCTG
CAGATCGACACAAATGTTACTGTTGCATTTGGTTGGCGGTTGAGCCAAAATGATCGCGGTTGCACAACCAACCTCTATTTTGCTTACTCCACATACCACA[T/A]
TTGACAATCAAATTGAGCTTTCTCACCACTATTCATATCAGGTCACCTCCACCACCTCCTACTCTCGTTGAACAATGTAACCTAAAGCCTTCATCTAGCG
| Populations | Population Size | Frequency of T(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 67.80% | 30.10% | 2.01% | 0.06% | NA |
| All Indica | 2759 | 97.80% | 1.70% | 0.43% | 0.07% | NA |
| All Japonica | 1512 | 22.00% | 72.80% | 5.22% | 0.07% | NA |
| Aus | 269 | 42.00% | 57.20% | 0.74% | 0.00% | NA |
| Indica I | 595 | 99.30% | 0.30% | 0.34% | 0.00% | NA |
| Indica II | 465 | 94.80% | 4.90% | 0.22% | 0.00% | NA |
| Indica III | 913 | 99.30% | 0.30% | 0.22% | 0.11% | NA |
| Indica Intermediate | 786 | 96.60% | 2.40% | 0.89% | 0.13% | NA |
| Temperate Japonica | 767 | 15.90% | 75.00% | 9.00% | 0.13% | NA |
| Tropical Japonica | 504 | 20.40% | 79.00% | 0.60% | 0.00% | NA |
| Japonica Intermediate | 241 | 44.40% | 52.70% | 2.90% | 0.00% | NA |
| VI/Aromatic | 96 | 14.60% | 85.40% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 54.40% | 43.30% | 2.22% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0707066814 | A -> DEL | N | N | silent_mutation | Average:46.867; most accessible tissue: Callus, score: 81.175 | N | N | N | N |
| vg0707066814 | A -> T | LOC_Os07g12400.1 | downstream_gene_variant ; 3702.0bp to feature; MODIFIER | silent_mutation | Average:46.867; most accessible tissue: Callus, score: 81.175 | N | N | N | N |
| vg0707066814 | A -> T | LOC_Os07g12390-LOC_Os07g12400 | intergenic_region ; MODIFIER | silent_mutation | Average:46.867; most accessible tissue: Callus, score: 81.175 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0707066814 | NA | 4.54E-10 | mr1195 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0707066814 | NA | 1.94E-10 | mr1648 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0707066814 | 3.11E-06 | NA | mr1008_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0707066814 | NA | 2.40E-06 | mr1053_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0707066814 | NA | 1.01E-12 | mr1147_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0707066814 | NA | 3.33E-09 | mr1379_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0707066814 | NA | 2.06E-06 | mr1559_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0707066814 | NA | 8.25E-13 | mr1713_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0707066814 | NA | 8.87E-06 | mr1713_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0707066814 | NA | 5.87E-06 | mr1788_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0707066814 | NA | 7.14E-06 | mr1872_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |