\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0707066814:

Variant ID: vg0707066814 (JBrowse)Variation Type: SNP
Chromosome: chr07Position: 7066814
Reference Allele: AAlternative Allele: T
Primary Allele: TSecondary Allele: A

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 1.01, others allele: 0.00, population size: 272. )

Flanking Sequence (100 bp) in Reference Genome:


CGCTAGATGAAGGCTTTAGGTTACATTGTTCAACGAGAGTAGGAGGTGGTGGAGGTGACCTGATATGAATAGTGGTGAGAAAGCTCAATTTGATTGTCAA[A/T]
TGTGGTATGTGGAGTAAGCAAAATAGAGGTTGGTTGTGCAACCGCGATCATTTTGGCTCAACCGCCAACCAAATGCAACAGTAACATTTGTGTCGATCTG

Reverse complement sequence

CAGATCGACACAAATGTTACTGTTGCATTTGGTTGGCGGTTGAGCCAAAATGATCGCGGTTGCACAACCAACCTCTATTTTGCTTACTCCACATACCACA[T/A]
TTGACAATCAAATTGAGCTTTCTCACCACTATTCATATCAGGTCACCTCCACCACCTCCTACTCTCGTTGAACAATGTAACCTAAAGCCTTCATCTAGCG

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 67.80% 30.10% 2.01% 0.06% NA
All Indica  2759 97.80% 1.70% 0.43% 0.07% NA
All Japonica  1512 22.00% 72.80% 5.22% 0.07% NA
Aus  269 42.00% 57.20% 0.74% 0.00% NA
Indica I  595 99.30% 0.30% 0.34% 0.00% NA
Indica II  465 94.80% 4.90% 0.22% 0.00% NA
Indica III  913 99.30% 0.30% 0.22% 0.11% NA
Indica Intermediate  786 96.60% 2.40% 0.89% 0.13% NA
Temperate Japonica  767 15.90% 75.00% 9.00% 0.13% NA
Tropical Japonica  504 20.40% 79.00% 0.60% 0.00% NA
Japonica Intermediate  241 44.40% 52.70% 2.90% 0.00% NA
VI/Aromatic  96 14.60% 85.40% 0.00% 0.00% NA
Intermediate  90 54.40% 43.30% 2.22% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0707066814 A -> DEL N N silent_mutation Average:46.867; most accessible tissue: Callus, score: 81.175 N N N N
vg0707066814 A -> T LOC_Os07g12400.1 downstream_gene_variant ; 3702.0bp to feature; MODIFIER silent_mutation Average:46.867; most accessible tissue: Callus, score: 81.175 N N N N
vg0707066814 A -> T LOC_Os07g12390-LOC_Os07g12400 intergenic_region ; MODIFIER silent_mutation Average:46.867; most accessible tissue: Callus, score: 81.175 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0707066814 NA 4.54E-10 mr1195 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0707066814 NA 1.94E-10 mr1648 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0707066814 3.11E-06 NA mr1008_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0707066814 NA 2.40E-06 mr1053_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0707066814 NA 1.01E-12 mr1147_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0707066814 NA 3.33E-09 mr1379_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0707066814 NA 2.06E-06 mr1559_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0707066814 NA 8.25E-13 mr1713_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0707066814 NA 8.87E-06 mr1713_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0707066814 NA 5.87E-06 mr1788_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0707066814 NA 7.14E-06 mr1872_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251