\
| Variant ID: vg0707063094 (JBrowse) | Variation Type: SNP |
| Chromosome: chr07 | Position: 7063094 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: T | Secondary Allele: C |
Inferred Ancestral Allele: Not determined.
AAAAATTATGGTTGTTTTAATATTCAACATTACTACGAAGTAAACGTTGGTTGTGATGGAATTTTCCCACTCGTGTTCATGTCCCAGAATTAAAATTCTT[T/C]
CAGTAGTAGGTGACGTACCCGTCGAAAGCGAGACGTACGTAGTGACTTCGTCCATCTCAAAATATGTCATCCTAGTCTATCAGAAGTACTCATGGGGGTA
TACCCCCATGAGTACTTCTGATAGACTAGGATGACATATTTTGAGATGGACGAAGTCACTACGTACGTCTCGCTTTCGACGGGTACGTCACCTACTACTG[A/G]
AAGAATTTTAATTCTGGGACATGAACACGAGTGGGAAAATTCCATCACAACCAACGTTTACTTCGTAGTAATGTTGAATATTAAAACAACCATAATTTTT
| Populations | Population Size | Frequency of T(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 91.20% | 7.70% | 0.32% | 0.72% | NA |
| All Indica | 2759 | 98.80% | 0.30% | 0.51% | 0.40% | NA |
| All Japonica | 1512 | 75.90% | 22.60% | 0.07% | 1.46% | NA |
| Aus | 269 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| Indica I | 595 | 99.20% | 0.00% | 0.17% | 0.67% | NA |
| Indica II | 465 | 98.10% | 1.50% | 0.43% | 0.00% | NA |
| Indica III | 913 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 97.60% | 0.10% | 1.40% | 0.89% | NA |
| Temperate Japonica | 767 | 97.10% | 2.60% | 0.13% | 0.13% | NA |
| Tropical Japonica | 504 | 33.50% | 62.50% | 0.00% | 3.97% | NA |
| Japonica Intermediate | 241 | 96.70% | 2.90% | 0.00% | 0.41% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 83.30% | 15.60% | 0.00% | 1.11% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0707063094 | T -> DEL | N | N | silent_mutation | Average:8.229; most accessible tissue: Minghui63 root, score: 15.664 | N | N | N | N |
| vg0707063094 | T -> C | LOC_Os07g12390-LOC_Os07g12400 | intergenic_region ; MODIFIER | silent_mutation | Average:8.229; most accessible tissue: Minghui63 root, score: 15.664 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0707063094 | NA | 7.09E-25 | mr1301 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0707063094 | NA | 1.25E-19 | mr1410 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0707063094 | NA | 6.55E-07 | mr1951 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0707063094 | NA | 2.00E-06 | mr1993 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0707063094 | 7.14E-07 | NA | mr1082_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0707063094 | 3.18E-07 | NA | mr1083_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0707063094 | 4.88E-07 | NA | mr1085_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0707063094 | NA | 2.47E-07 | mr1125_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0707063094 | NA | 1.38E-27 | mr1301_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0707063094 | NA | 5.40E-09 | mr1304_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0707063094 | NA | 7.61E-09 | mr1308_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0707063094 | NA | 9.80E-10 | mr1361_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0707063094 | 9.86E-06 | 1.48E-10 | mr1408_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0707063094 | NA | 1.99E-21 | mr1410_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0707063094 | NA | 6.50E-08 | mr1554_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0707063094 | NA | 1.34E-07 | mr1578_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0707063094 | NA | 2.53E-09 | mr1584_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0707063094 | NA | 1.30E-07 | mr1696_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0707063094 | NA | 1.95E-09 | mr1705_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0707063094 | NA | 1.27E-08 | mr1819_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0707063094 | NA | 1.61E-07 | mr1860_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0707063094 | NA | 3.30E-11 | mr1905_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0707063094 | NA | 1.14E-06 | mr1905_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0707063094 | NA | 6.64E-16 | mr1993_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0707063094 | NA | 1.07E-12 | mr1993_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |