Variant ID: vg0707032320 (JBrowse) | Variation Type: SNP |
Chromosome: chr07 | Position: 7032320 |
Reference Allele: C | Alternative Allele: T |
Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.99, others allele: 0.00, population size: 309. )
TATCATACCAGGATATATCACGTCCTGTATGAGATTGGCTTATTTTGGGACAGAGAGAGTATCTTTTTTGGTGAATGATACAGTAGGTTTAGGAGGCATC[C/T]
GGACTAGTACATAGCTTAAACTCAATGTGGTTGACAGTGAAGTGGAGAAATCAAGGGAGATATATAGGGCCTGTTTGGTACAGCTCTAACTCCTAAATTT
AAATTTAGGAGTTAGAGCTGTACCAAACAGGCCCTATATATCTCCCTTGATTTCTCCACTTCACTGTCAACCACATTGAGTTTAAGCTATGTACTAGTCC[G/A]
GATGCCTCCTAAACCTACTGTATCATTCACCAAAAAAGATACTCTCTCTGTCCCAAAATAAGCCAATCTCATACAGGACGTGATATATCCTGGTATGATA
Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
---|---|---|---|---|---|---|
All | 4726 | 95.80% | 3.60% | 0.61% | 0.00% | NA |
All Indica | 2759 | 99.70% | 0.20% | 0.11% | 0.00% | NA |
All Japonica | 1512 | 93.70% | 4.90% | 1.39% | 0.00% | NA |
Aus | 269 | 99.60% | 0.00% | 0.37% | 0.00% | NA |
Indica I | 595 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
Indica II | 465 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
Indica III | 913 | 99.70% | 0.30% | 0.00% | 0.00% | NA |
Indica Intermediate | 786 | 99.20% | 0.40% | 0.38% | 0.00% | NA |
Temperate Japonica | 767 | 92.60% | 5.10% | 2.35% | 0.00% | NA |
Tropical Japonica | 504 | 97.60% | 2.40% | 0.00% | 0.00% | NA |
Japonica Intermediate | 241 | 89.20% | 9.50% | 1.24% | 0.00% | NA |
VI/Aromatic | 96 | 14.60% | 83.30% | 2.08% | 0.00% | NA |
Intermediate | 90 | 88.90% | 8.90% | 2.22% | 0.00% | NA |
Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
---|---|---|---|---|---|---|---|---|---|
vg0707032320 | C -> T | LOC_Os07g12370.1 | downstream_gene_variant ; 305.0bp to feature; MODIFIER | silent_mutation | Average:64.519; most accessible tissue: Callus, score: 85.102 | N | N | N | N |
vg0707032320 | C -> T | LOC_Os07g12360-LOC_Os07g12370 | intergenic_region ; MODIFIER | silent_mutation | Average:64.519; most accessible tissue: Callus, score: 85.102 | N | N | N | N |
Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
---|---|---|---|---|---|---|
vg0707032320 | 3.97E-08 | NA | mr1757 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0707032320 | NA | 1.58E-08 | mr1757 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0707032320 | NA | 1.60E-07 | mr1829 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0707032320 | 6.35E-06 | NA | mr1310_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0707032320 | NA | 3.16E-06 | mr1549_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0707032320 | NA | 8.68E-07 | mr1567_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0707032320 | 5.01E-06 | NA | mr1757_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0707032320 | NA | 3.65E-07 | mr1757_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0707032320 | NA | 1.48E-10 | mr1829_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |