\
| Variant ID: vg0706910489 (JBrowse) | Variation Type: SNP |
| Chromosome: chr07 | Position: 6910489 |
| Reference Allele: A | Alternative Allele: G,T |
| Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.99, T: 0.00, others allele: 0.00, population size: 309. )
TCCTATTTGACACTCCTTTGCTTTAAAAGGCAGATTGCGTAGATGAGGAGCTTGTATAGTGTCCTAGTCTTAACCTTTTGGTTGTTTCTTATGAGAAAAG[A/G,T]
GGAGTGAACCTGCTCACTGATACGATGCTCCAGTGTTCTCTAACAGTTTAATTATACTACCATTATTTTTAGGGCTAAATTAGTAATCTATTAATACCAT
ATGGTATTAATAGATTACTAATTTAGCCCTAAAAATAATGGTAGTATAATTAAACTGTTAGAGAACACTGGAGCATCGTATCAGTGAGCAGGTTCACTCC[T/C,A]
CTTTTCTCATAAGAAACAACCAAAAGGTTAAGACTAGGACACTATACAAGCTCCTCATCTACGCAATCTGCCTTTTAAAGCAAAGGAGTGTCAAATAGGA
| Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 99.00% | 0.80% | 0.15% | 0.00% | T: 0.04% |
| All Indica | 2759 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| All Japonica | 1512 | 97.00% | 2.50% | 0.46% | 0.00% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica II | 465 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica III | 913 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 99.70% | 0.10% | 0.13% | 0.00% | NA |
| Tropical Japonica | 504 | 92.30% | 6.50% | 1.19% | 0.00% | NA |
| Japonica Intermediate | 241 | 98.30% | 1.70% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 97.80% | 0.00% | 0.00% | 0.00% | T: 2.22% |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0706910489 | A -> G | LOC_Os07g12290-LOC_Os07g12300 | intergenic_region ; MODIFIER | silent_mutation | Average:51.715; most accessible tissue: Callus, score: 88.348 | N | N | N | N |
| vg0706910489 | A -> T | LOC_Os07g12290-LOC_Os07g12300 | intergenic_region ; MODIFIER | silent_mutation | Average:51.715; most accessible tissue: Callus, score: 88.348 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0706910489 | NA | 1.22E-06 | mr1232_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0706910489 | NA | 7.76E-07 | mr1415_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0706910489 | 9.96E-07 | 9.95E-07 | mr1424_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0706910489 | NA | 1.28E-07 | mr1557_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0706910489 | NA | 3.40E-07 | mr1558_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0706910489 | 2.66E-07 | 2.66E-07 | mr1562_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0706910489 | NA | 2.77E-06 | mr1575_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0706910489 | NA | 3.27E-06 | mr1849_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0706910489 | NA | 9.40E-06 | mr1884_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0706910489 | NA | 2.03E-06 | mr1905_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0706910489 | NA | 6.53E-07 | mr1944_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |