\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0706798160:

Variant ID: vg0706798160 (JBrowse)Variation Type: SNP
Chromosome: chr07Position: 6798160
Reference Allele: AAlternative Allele: G
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.63, G: 0.38, others allele: 0.00, population size: 86. )

Flanking Sequence (100 bp) in Reference Genome:


TAGTGGCTAGTACCATTAGATCACTTCATTGAATTGTAATAACAAATAACAGGATATTCAAGTGAAAACCCAAAAAAATGCAGCCATTGTACAGATCAAT[A/G]
AAACCTTAACTTTGAAATCATCCATCAAATGAACGAAAAATAGAAATCTACAACCATCAGCAAGTGATTTACCATAACAAGCTAGGAGCAAATTGTCGGC

Reverse complement sequence

GCCGACAATTTGCTCCTAGCTTGTTATGGTAAATCACTTGCTGATGGTTGTAGATTTCTATTTTTCGTTCATTTGATGGATGATTTCAAAGTTAAGGTTT[T/C]
ATTGATCTGTACAATGGCTGCATTTTTTTGGGTTTTCACTTGAATATCCTGTTATTTGTTATTACAATTCAATGAAGTGATCTAATGGTACTAGCCACTA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 68.50% 31.20% 0.23% 0.08% NA
All Indica  2759 97.80% 1.80% 0.29% 0.14% NA
All Japonica  1512 10.40% 89.60% 0.00% 0.00% NA
Aus  269 95.20% 4.50% 0.37% 0.00% NA
Indica I  595 99.70% 0.20% 0.00% 0.17% NA
Indica II  465 94.60% 4.90% 0.22% 0.22% NA
Indica III  913 99.10% 0.40% 0.22% 0.22% NA
Indica Intermediate  786 96.60% 2.80% 0.64% 0.00% NA
Temperate Japonica  767 18.00% 82.00% 0.00% 0.00% NA
Tropical Japonica  504 1.00% 99.00% 0.00% 0.00% NA
Japonica Intermediate  241 5.80% 94.20% 0.00% 0.00% NA
VI/Aromatic  96 76.00% 24.00% 0.00% 0.00% NA
Intermediate  90 58.90% 38.90% 2.22% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0706798160 A -> DEL N N silent_mutation Average:37.449; most accessible tissue: Zhenshan97 panicle, score: 57.341 N N N N
vg0706798160 A -> G LOC_Os07g12150.1 upstream_gene_variant ; 816.0bp to feature; MODIFIER silent_mutation Average:37.449; most accessible tissue: Zhenshan97 panicle, score: 57.341 N N N N
vg0706798160 A -> G LOC_Os07g12140.1 downstream_gene_variant ; 1548.0bp to feature; MODIFIER silent_mutation Average:37.449; most accessible tissue: Zhenshan97 panicle, score: 57.341 N N N N
vg0706798160 A -> G LOC_Os07g12140.2 downstream_gene_variant ; 1529.0bp to feature; MODIFIER silent_mutation Average:37.449; most accessible tissue: Zhenshan97 panicle, score: 57.341 N N N N
vg0706798160 A -> G LOC_Os07g12140-LOC_Os07g12150 intergenic_region ; MODIFIER silent_mutation Average:37.449; most accessible tissue: Zhenshan97 panicle, score: 57.341 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0706798160 NA 7.22E-12 mr1138 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706798160 NA 6.16E-28 mr1238 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706798160 NA 9.53E-29 mr1309 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706798160 NA 1.13E-15 mr1484 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706798160 NA 1.79E-18 mr1518 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706798160 NA 1.57E-06 mr1761 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706798160 NA 2.66E-13 mr1900 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706798160 NA 2.79E-11 mr1949 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706798160 NA 4.93E-12 mr1138_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706798160 NA 2.62E-31 mr1238_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706798160 NA 4.55E-16 mr1342_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706798160 NA 3.76E-28 mr1484_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706798160 NA 2.13E-15 mr1578_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706798160 NA 1.63E-12 mr1666_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706798160 NA 6.74E-11 mr1705_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706798160 NA 1.54E-07 mr1749_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706798160 NA 4.71E-11 mr1761_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706798160 NA 1.76E-33 mr1841_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706798160 NA 2.86E-22 mr1900_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706798160 NA 1.36E-22 mr1945_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251