Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0706798160:

Variant ID: vg0706798160 (JBrowse)	Variation Type: SNP
Chromosome: chr07	Position: 6798160
Reference Allele: A	Alternative Allele: G
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.63, G: 0.38, others allele: 0.00, population size: 86. )

Flanking Sequence (100 bp) in Reference Genome:

TAGTGGCTAGTACCATTAGATCACTTCATTGAATTGTAATAACAAATAACAGGATATTCAAGTGAAAACCCAAAAAAATGCAGCCATTGTACAGATCAAT[A/G]
AAACCTTAACTTTGAAATCATCCATCAAATGAACGAAAAATAGAAATCTACAACCATCAGCAAGTGATTTACCATAACAAGCTAGGAGCAAATTGTCGGC

Reverse complement sequence

GCCGACAATTTGCTCCTAGCTTGTTATGGTAAATCACTTGCTGATGGTTGTAGATTTCTATTTTTCGTTCATTTGATGGATGATTTCAAAGTTAAGGTTT[T/C]
ATTGATCTGTACAATGGCTGCATTTTTTTGGGTTTTCACTTGAATATCCTGTTATTTGTTATTACAATTCAATGAAGTGATCTAATGGTACTAGCCACTA

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	68.50%	31.20%	0.23%	0.08%	NA
All Indica	2759	97.80%	1.80%	0.29%	0.14%	NA
All Japonica	1512	10.40%	89.60%	0.00%	0.00%	NA
Aus	269	95.20%	4.50%	0.37%	0.00%	NA
Indica I	595	99.70%	0.20%	0.00%	0.17%	NA
Indica II	465	94.60%	4.90%	0.22%	0.22%	NA
Indica III	913	99.10%	0.40%	0.22%	0.22%	NA
Indica Intermediate	786	96.60%	2.80%	0.64%	0.00%	NA
Temperate Japonica	767	18.00%	82.00%	0.00%	0.00%	NA
Tropical Japonica	504	1.00%	99.00%	0.00%	0.00%	NA
Japonica Intermediate	241	5.80%	94.20%	0.00%	0.00%	NA
VI/Aromatic	96	76.00%	24.00%	0.00%	0.00%	NA
Intermediate	90	58.90%	38.90%	2.22%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0706798160	A -> DEL	N	N	silent_mutation	Average:37.449; most accessible tissue: Zhenshan97 panicle, score: 57.341	N	N	N	N
vg0706798160	A -> G	LOC_Os07g12150.1	upstream_gene_variant ; 816.0bp to feature; MODIFIER	silent_mutation	Average:37.449; most accessible tissue: Zhenshan97 panicle, score: 57.341	N	N	N	N
vg0706798160	A -> G	LOC_Os07g12140.1	downstream_gene_variant ; 1548.0bp to feature; MODIFIER	silent_mutation	Average:37.449; most accessible tissue: Zhenshan97 panicle, score: 57.341	N	N	N	N
vg0706798160	A -> G	LOC_Os07g12140.2	downstream_gene_variant ; 1529.0bp to feature; MODIFIER	silent_mutation	Average:37.449; most accessible tissue: Zhenshan97 panicle, score: 57.341	N	N	N	N
vg0706798160	A -> G	LOC_Os07g12140-LOC_Os07g12150	intergenic_region ; MODIFIER	silent_mutation	Average:37.449; most accessible tissue: Zhenshan97 panicle, score: 57.341	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0706798160	NA	7.22E-12	mr1138	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706798160	NA	6.16E-28	mr1238	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706798160	NA	9.53E-29	mr1309	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706798160	NA	1.13E-15	mr1484	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706798160	NA	1.79E-18	mr1518	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706798160	NA	1.57E-06	mr1761	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706798160	NA	2.66E-13	mr1900	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706798160	NA	2.79E-11	mr1949	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706798160	NA	4.93E-12	mr1138_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706798160	NA	2.62E-31	mr1238_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706798160	NA	4.55E-16	mr1342_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706798160	NA	3.76E-28	mr1484_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706798160	NA	2.13E-15	mr1578_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706798160	NA	1.63E-12	mr1666_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706798160	NA	6.74E-11	mr1705_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706798160	NA	1.54E-07	mr1749_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706798160	NA	4.71E-11	mr1761_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706798160	NA	1.76E-33	mr1841_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706798160	NA	2.86E-22	mr1900_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706798160	NA	1.36E-22	mr1945_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251