\
| Variant ID: vg0706786499 (JBrowse) | Variation Type: SNP |
| Chromosome: chr07 | Position: 6786499 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 1.01, others allele: 0.00, population size: 272. )
TCTGAACTCAAATCAAAGGCAGAATCTAAATAGACATCAAACATCTAATCTGAACTCTTTGACAATTAATAGATACCTATCATAGAGAAACCTTTCTCTA[A/G]
GCTAGGAAGCTTGCTTCTTGTTCCAGATTTAATCTTATTCTAAAATAGGTTACTTTGCTTTCCGCTCTATCAGAAAACGTTCTAACGTATTGATTCCGTA
TACGGAATCAATACGTTAGAACGTTTTCTGATAGAGCGGAAAGCAAAGTAACCTATTTTAGAATAAGATTAAATCTGGAACAAGAAGCAAGCTTCCTAGC[T/C]
TAGAGAAAGGTTTCTCTATGATAGGTATCTATTAATTGTCAAAGAGTTCAGATTAGATGTTTGATGTCTATTTAGATTCTGCCTTTGATTTGAGTTCAGA
| Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 99.40% | 0.40% | 0.25% | 0.00% | NA |
| All Indica | 2759 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| All Japonica | 1512 | 98.20% | 1.00% | 0.79% | 0.00% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 99.80% | 0.20% | 0.00% | 0.00% | NA |
| Indica II | 465 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica III | 913 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 94.60% | 3.00% | 2.38% | 0.00% | NA |
| Japonica Intermediate | 241 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 98.90% | 1.10% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0706786499 | A -> G | LOC_Os07g12130.1 | upstream_gene_variant ; 4820.0bp to feature; MODIFIER | silent_mutation | Average:28.368; most accessible tissue: Callus, score: 41.577 | N | N | N | N |
| vg0706786499 | A -> G | LOC_Os07g12140.1 | upstream_gene_variant ; 4187.0bp to feature; MODIFIER | silent_mutation | Average:28.368; most accessible tissue: Callus, score: 41.577 | N | N | N | N |
| vg0706786499 | A -> G | LOC_Os07g12140.2 | upstream_gene_variant ; 4187.0bp to feature; MODIFIER | silent_mutation | Average:28.368; most accessible tissue: Callus, score: 41.577 | N | N | N | N |
| vg0706786499 | A -> G | LOC_Os07g12130-LOC_Os07g12140 | intergenic_region ; MODIFIER | silent_mutation | Average:28.368; most accessible tissue: Callus, score: 41.577 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0706786499 | 5.47E-07 | 5.47E-07 | mr1159_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0706786499 | 3.76E-06 | 3.75E-06 | mr1286_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0706786499 | 5.67E-07 | 5.67E-07 | mr1312_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0706786499 | 6.77E-06 | 6.77E-06 | mr1335_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0706786499 | NA | 2.96E-06 | mr1363_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0706786499 | 7.30E-06 | 7.30E-06 | mr1373_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0706786499 | NA | 8.61E-06 | mr1397_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0706786499 | NA | 4.83E-07 | mr1646_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0706786499 | 9.67E-06 | 9.66E-06 | mr1663_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0706786499 | 1.97E-06 | 4.86E-07 | mr1665_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0706786499 | NA | 1.82E-06 | mr1738_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0706786499 | NA | 1.82E-07 | mr1798_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0706786499 | NA | 2.29E-08 | mr1800_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |