\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0706786499:

Variant ID: vg0706786499 (JBrowse)Variation Type: SNP
Chromosome: chr07Position: 6786499
Reference Allele: AAlternative Allele: G
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 1.01, others allele: 0.00, population size: 272. )

Flanking Sequence (100 bp) in Reference Genome:


TCTGAACTCAAATCAAAGGCAGAATCTAAATAGACATCAAACATCTAATCTGAACTCTTTGACAATTAATAGATACCTATCATAGAGAAACCTTTCTCTA[A/G]
GCTAGGAAGCTTGCTTCTTGTTCCAGATTTAATCTTATTCTAAAATAGGTTACTTTGCTTTCCGCTCTATCAGAAAACGTTCTAACGTATTGATTCCGTA

Reverse complement sequence

TACGGAATCAATACGTTAGAACGTTTTCTGATAGAGCGGAAAGCAAAGTAACCTATTTTAGAATAAGATTAAATCTGGAACAAGAAGCAAGCTTCCTAGC[T/C]
TAGAGAAAGGTTTCTCTATGATAGGTATCTATTAATTGTCAAAGAGTTCAGATTAGATGTTTGATGTCTATTTAGATTCTGCCTTTGATTTGAGTTCAGA

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 99.40% 0.40% 0.25% 0.00% NA
All Indica  2759 100.00% 0.00% 0.00% 0.00% NA
All Japonica  1512 98.20% 1.00% 0.79% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 99.80% 0.20% 0.00% 0.00% NA
Indica II  465 100.00% 0.00% 0.00% 0.00% NA
Indica III  913 100.00% 0.00% 0.00% 0.00% NA
Indica Intermediate  786 100.00% 0.00% 0.00% 0.00% NA
Temperate Japonica  767 100.00% 0.00% 0.00% 0.00% NA
Tropical Japonica  504 94.60% 3.00% 2.38% 0.00% NA
Japonica Intermediate  241 100.00% 0.00% 0.00% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 98.90% 1.10% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0706786499 A -> G LOC_Os07g12130.1 upstream_gene_variant ; 4820.0bp to feature; MODIFIER silent_mutation Average:28.368; most accessible tissue: Callus, score: 41.577 N N N N
vg0706786499 A -> G LOC_Os07g12140.1 upstream_gene_variant ; 4187.0bp to feature; MODIFIER silent_mutation Average:28.368; most accessible tissue: Callus, score: 41.577 N N N N
vg0706786499 A -> G LOC_Os07g12140.2 upstream_gene_variant ; 4187.0bp to feature; MODIFIER silent_mutation Average:28.368; most accessible tissue: Callus, score: 41.577 N N N N
vg0706786499 A -> G LOC_Os07g12130-LOC_Os07g12140 intergenic_region ; MODIFIER silent_mutation Average:28.368; most accessible tissue: Callus, score: 41.577 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0706786499 5.47E-07 5.47E-07 mr1159_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706786499 3.76E-06 3.75E-06 mr1286_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706786499 5.67E-07 5.67E-07 mr1312_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706786499 6.77E-06 6.77E-06 mr1335_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706786499 NA 2.96E-06 mr1363_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706786499 7.30E-06 7.30E-06 mr1373_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706786499 NA 8.61E-06 mr1397_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706786499 NA 4.83E-07 mr1646_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706786499 9.67E-06 9.66E-06 mr1663_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706786499 1.97E-06 4.86E-07 mr1665_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706786499 NA 1.82E-06 mr1738_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706786499 NA 1.82E-07 mr1798_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706786499 NA 2.29E-08 mr1800_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251