\
| Variant ID: vg0706750728 (JBrowse) | Variation Type: SNP |
| Chromosome: chr07 | Position: 6750728 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: T | Secondary Allele: C |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.74, T: 0.26, others allele: 0.00, population size: 82. )
ACTGCATGTGGAGGATATATGGGTTAATGTATCACATGCTAAATATATTTGTTACTACACAAAAGTGGAGTGTTATTGCAAAGGCAGGTACACGTTACCA[C/T]
ATATTTATGCAGTAACACTATCCAAAAAATACAGTAAAACACAGTTACTGCAAAAACTTATAATTTTTGCTGCACTCTTACAGTAATGATGCGATGGGAT
ATCCCATCGCATCATTACTGTAAGAGTGCAGCAAAAATTATAAGTTTTTGCAGTAACTGTGTTTTACTGTATTTTTTGGATAGTGTTACTGCATAAATAT[G/A]
TGGTAACGTGTACCTGCCTTTGCAATAACACTCCACTTTTGTGTAGTAACAAATATATTTAGCATGTGATACATTAACCCATATATCCTCCACATGCAGT
| Populations | Population Size | Frequency of T(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 60.60% | 37.70% | 0.76% | 0.91% | NA |
| All Indica | 2759 | 93.80% | 3.70% | 1.12% | 1.41% | NA |
| All Japonica | 1512 | 0.50% | 99.50% | 0.07% | 0.00% | NA |
| Aus | 269 | 85.10% | 13.00% | 0.74% | 1.12% | NA |
| Indica I | 595 | 94.50% | 1.80% | 2.52% | 1.18% | NA |
| Indica II | 465 | 94.40% | 5.60% | 0.00% | 0.00% | NA |
| Indica III | 913 | 96.40% | 2.00% | 0.33% | 1.31% | NA |
| Indica Intermediate | 786 | 89.80% | 6.00% | 1.65% | 2.54% | NA |
| Temperate Japonica | 767 | 0.30% | 99.60% | 0.13% | 0.00% | NA |
| Tropical Japonica | 504 | 0.40% | 99.60% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 1.20% | 98.80% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 3.10% | 94.80% | 1.04% | 1.04% | NA |
| Intermediate | 90 | 43.30% | 55.60% | 1.11% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0706750728 | C -> DEL | N | N | silent_mutation | Average:25.663; most accessible tissue: Zhenshan97 panicle, score: 39.652 | N | N | N | N |
| vg0706750728 | C -> T | LOC_Os07g12080.1 | upstream_gene_variant ; 4384.0bp to feature; MODIFIER | silent_mutation | Average:25.663; most accessible tissue: Zhenshan97 panicle, score: 39.652 | N | N | N | N |
| vg0706750728 | C -> T | LOC_Os07g12090.1 | upstream_gene_variant ; 3565.0bp to feature; MODIFIER | silent_mutation | Average:25.663; most accessible tissue: Zhenshan97 panicle, score: 39.652 | N | N | N | N |
| vg0706750728 | C -> T | LOC_Os07g12100.1 | intron_variant ; MODIFIER | silent_mutation | Average:25.663; most accessible tissue: Zhenshan97 panicle, score: 39.652 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0706750728 | NA | 5.32E-30 | mr1107 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0706750728 | NA | 3.42E-07 | mr1107 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0706750728 | NA | 1.06E-12 | mr1170 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0706750728 | NA | 6.88E-36 | mr1082_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0706750728 | 2.70E-07 | NA | mr1082_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0706750728 | NA | 8.41E-32 | mr1083_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0706750728 | 1.30E-06 | NA | mr1083_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0706750728 | NA | 2.72E-32 | mr1085_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0706750728 | 7.97E-06 | NA | mr1128_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0706750728 | NA | 2.18E-44 | mr1145_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0706750728 | 2.23E-06 | NA | mr1145_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0706750728 | NA | 1.67E-35 | mr1155_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0706750728 | NA | 6.23E-08 | mr1212_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0706750728 | NA | 2.37E-12 | mr1216_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0706750728 | NA | 2.99E-24 | mr1233_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0706750728 | NA | 3.21E-40 | mr1264_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0706750728 | NA | 8.32E-08 | mr1408_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0706750728 | NA | 5.96E-17 | mr1592_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0706750728 | NA | 2.32E-22 | mr1609_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0706750728 | NA | 3.08E-06 | mr1620_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0706750728 | NA | 3.88E-09 | mr1705_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0706750728 | NA | 9.10E-07 | mr1727_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0706750728 | NA | 2.13E-07 | mr1804_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0706750728 | NA | 2.50E-07 | mr1915_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0706750728 | NA | 6.29E-09 | mr1947_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |