\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0706750438:

Variant ID: vg0706750438 (JBrowse)Variation Type: SNP
Chromosome: chr07Position: 6750438
Reference Allele: TAlternative Allele: C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.92, C: 0.08, others allele: 0.00, population size: 78. )

Flanking Sequence (100 bp) in Reference Genome:


TAATCATAGTTTTACTATGTCAGTTTTACGAGATGAAGATCGAATAGGTGGGCTATAGGTAAAGTCTGTAGATGGCTTTGAGTGAGGTCTGATTAATGTA[T/C]
AAGTGTTTTGAACAATTTTATACATTTGGTAAAACCATGTTACTGCATGTATATACCCATGTTACTGCAAATTACATATTCTATTACTGTATATGGAGTG

Reverse complement sequence

CACTCCATATACAGTAATAGAATATGTAATTTGCAGTAACATGGGTATATACATGCAGTAACATGGTTTTACCAAATGTATAAAATTGTTCAAAACACTT[A/G]
TACATTAATCAGACCTCACTCAAAGCCATCTACAGACTTTACCTATAGCCCACCTATTCGATCTTCATCTCGTAAAACTGACATAGTAAAACTATGATTA

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 37.90% 1.10% 11.89% 49.03% NA
All Indica  2759 4.20% 1.70% 15.04% 78.98% NA
All Japonica  1512 99.40% 0.00% 0.13% 0.46% NA
Aus  269 11.50% 2.20% 51.30% 34.94% NA
Indica I  595 1.50% 1.80% 3.36% 93.28% NA
Indica II  465 6.90% 2.40% 6.88% 83.87% NA
Indica III  913 3.20% 1.00% 28.04% 67.80% NA
Indica Intermediate  786 6.00% 2.20% 13.61% 78.24% NA
Temperate Japonica  767 99.60% 0.00% 0.00% 0.39% NA
Tropical Japonica  504 99.60% 0.00% 0.20% 0.20% NA
Japonica Intermediate  241 98.30% 0.00% 0.41% 1.24% NA
VI/Aromatic  96 93.80% 0.00% 1.04% 5.21% NA
Intermediate  90 57.80% 0.00% 6.67% 35.56% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0706750438 T -> DEL N N silent_mutation Average:16.377; most accessible tissue: Callus, score: 22.231 N N N N
vg0706750438 T -> C LOC_Os07g12080.1 upstream_gene_variant ; 4094.0bp to feature; MODIFIER silent_mutation Average:16.377; most accessible tissue: Callus, score: 22.231 N N N N
vg0706750438 T -> C LOC_Os07g12090.1 upstream_gene_variant ; 3275.0bp to feature; MODIFIER silent_mutation Average:16.377; most accessible tissue: Callus, score: 22.231 N N N N
vg0706750438 T -> C LOC_Os07g12100.1 intron_variant ; MODIFIER silent_mutation Average:16.377; most accessible tissue: Callus, score: 22.231 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0706750438 NA 4.11E-06 mr1103 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706750438 NA 9.46E-30 mr1107 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706750438 NA 9.71E-08 mr1107 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706750438 8.40E-06 NA mr1076_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706750438 NA 3.46E-35 mr1082_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706750438 2.64E-06 NA mr1082_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706750438 3.33E-06 NA mr1083_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706750438 NA 7.86E-32 mr1085_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706750438 NA 3.38E-66 mr1103_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706750438 3.60E-06 NA mr1103_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706750438 NA 1.58E-35 mr1107_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706750438 NA 4.23E-42 mr1145_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706750438 NA 1.26E-11 mr1216_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706750438 NA 2.54E-24 mr1233_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706750438 NA 1.56E-38 mr1264_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706750438 NA 4.71E-07 mr1408_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706750438 NA 8.85E-44 mr1437_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706750438 NA 7.49E-23 mr1609_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706750438 NA 8.48E-32 mr1841_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706750438 NA 1.29E-06 mr1915_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706750438 NA 6.84E-09 mr1947_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251