\
| Variant ID: vg0706732811 (JBrowse) | Variation Type: SNP |
| Chromosome: chr07 | Position: 6732811 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
AAGCAATTTTCCTCATGGCCGAGAAGCTACCGCCATCGCCGTCCTCAGCTAGCCCTAGTTCCGTTAAGGAAAAGATCCAGAAGTTAGGTTTGACTGACGT[C/T]
AATGAAGGAAACATCGTGCCCATCACTCCAGATAAGTTGACGCCCGATCAGAAGAAAGAGCTCGAAGCAATGATGCAACAAACACGAGATCAGTTCTTAA
TTAAGAACTGATCTCGTGTTTGTTGCATCATTGCTTCGAGCTCTTTCTTCTGATCGGGCGTCAACTTATCTGGAGTGATGGGCACGATGTTTCCTTCATT[G/A]
ACGTCAGTCAAACCTAACTTCTGGATCTTTTCCTTAACGGAACTAGGGCTAGCTGAGGACGGCGATGGCGGTAGCTTCTCGGCCATGAGGAAAATTGCTT
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 94.20% | 0.50% | 1.21% | 4.08% | NA |
| All Indica | 2759 | 97.20% | 0.00% | 0.58% | 2.25% | NA |
| All Japonica | 1512 | 89.10% | 1.50% | 2.45% | 6.94% | NA |
| Aus | 269 | 90.30% | 0.00% | 1.12% | 8.55% | NA |
| Indica I | 595 | 96.10% | 0.00% | 1.18% | 2.69% | NA |
| Indica II | 465 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica III | 913 | 98.10% | 0.00% | 0.33% | 1.53% | NA |
| Indica Intermediate | 786 | 95.20% | 0.00% | 0.76% | 4.07% | NA |
| Temperate Japonica | 767 | 83.70% | 0.00% | 3.52% | 12.78% | NA |
| Tropical Japonica | 504 | 93.50% | 4.60% | 1.79% | 0.20% | NA |
| Japonica Intermediate | 241 | 97.10% | 0.00% | 0.41% | 2.49% | NA |
| VI/Aromatic | 96 | 96.90% | 0.00% | 0.00% | 3.12% | NA |
| Intermediate | 90 | 97.80% | 1.10% | 1.11% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0706732811 | C -> DEL | N | N | silent_mutation | Average:42.693; most accessible tissue: Zhenshan97 young leaf, score: 63.653 | N | N | N | N |
| vg0706732811 | C -> T | LOC_Os07g12060.1 | splice_region_variant&intron_variant ; LOW | silent_mutation | Average:42.693; most accessible tissue: Zhenshan97 young leaf, score: 63.653 | N | N | N | N |
| vg0706732811 | C -> T | LOC_Os07g12050.1 | upstream_gene_variant ; 3047.0bp to feature; MODIFIER | silent_mutation | Average:42.693; most accessible tissue: Zhenshan97 young leaf, score: 63.653 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0706732811 | 2.55E-06 | NA | mr1699 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0706732811 | 3.01E-07 | 3.01E-07 | mr1159_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0706732811 | 2.18E-06 | 2.18E-06 | mr1286_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0706732811 | 4.81E-06 | 4.81E-06 | mr1312_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0706732811 | 1.88E-06 | 1.88E-06 | mr1335_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0706732811 | NA | 2.51E-06 | mr1363_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0706732811 | 2.51E-06 | 2.51E-06 | mr1373_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0706732811 | NA | 7.68E-06 | mr1397_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0706732811 | NA | 3.25E-07 | mr1646_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0706732811 | 5.25E-06 | 5.25E-06 | mr1663_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0706732811 | 1.03E-06 | 3.02E-07 | mr1665_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0706732811 | 8.41E-06 | 8.41E-06 | mr1687_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0706732811 | NA | 4.69E-07 | mr1738_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0706732811 | NA | 5.37E-07 | mr1798_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |