Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0706732811:

Variant ID: vg0706732811 (JBrowse)	Variation Type: SNP
Chromosome: chr07	Position: 6732811
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

AAGCAATTTTCCTCATGGCCGAGAAGCTACCGCCATCGCCGTCCTCAGCTAGCCCTAGTTCCGTTAAGGAAAAGATCCAGAAGTTAGGTTTGACTGACGT[C/T]
AATGAAGGAAACATCGTGCCCATCACTCCAGATAAGTTGACGCCCGATCAGAAGAAAGAGCTCGAAGCAATGATGCAACAAACACGAGATCAGTTCTTAA

Reverse complement sequence

TTAAGAACTGATCTCGTGTTTGTTGCATCATTGCTTCGAGCTCTTTCTTCTGATCGGGCGTCAACTTATCTGGAGTGATGGGCACGATGTTTCCTTCATT[G/A]
ACGTCAGTCAAACCTAACTTCTGGATCTTTTCCTTAACGGAACTAGGGCTAGCTGAGGACGGCGATGGCGGTAGCTTCTCGGCCATGAGGAAAATTGCTT

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	94.20%	0.50%	1.21%	4.08%	NA
All Indica	2759	97.20%	0.00%	0.58%	2.25%	NA
All Japonica	1512	89.10%	1.50%	2.45%	6.94%	NA
Aus	269	90.30%	0.00%	1.12%	8.55%	NA
Indica I	595	96.10%	0.00%	1.18%	2.69%	NA
Indica II	465	100.00%	0.00%	0.00%	0.00%	NA
Indica III	913	98.10%	0.00%	0.33%	1.53%	NA
Indica Intermediate	786	95.20%	0.00%	0.76%	4.07%	NA
Temperate Japonica	767	83.70%	0.00%	3.52%	12.78%	NA
Tropical Japonica	504	93.50%	4.60%	1.79%	0.20%	NA
Japonica Intermediate	241	97.10%	0.00%	0.41%	2.49%	NA
VI/Aromatic	96	96.90%	0.00%	0.00%	3.12%	NA
Intermediate	90	97.80%	1.10%	1.11%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0706732811	C -> DEL	N	N	silent_mutation	Average:42.693; most accessible tissue: Zhenshan97 young leaf, score: 63.653	N	N	N	N
vg0706732811	C -> T	LOC_Os07g12060.1	splice_region_variant&intron_variant ; LOW	silent_mutation	Average:42.693; most accessible tissue: Zhenshan97 young leaf, score: 63.653	N	N	N	N
vg0706732811	C -> T	LOC_Os07g12050.1	upstream_gene_variant ; 3047.0bp to feature; MODIFIER	silent_mutation	Average:42.693; most accessible tissue: Zhenshan97 young leaf, score: 63.653	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0706732811	2.55E-06	NA	mr1699	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706732811	3.01E-07	3.01E-07	mr1159_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706732811	2.18E-06	2.18E-06	mr1286_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706732811	4.81E-06	4.81E-06	mr1312_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706732811	1.88E-06	1.88E-06	mr1335_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706732811	NA	2.51E-06	mr1363_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706732811	2.51E-06	2.51E-06	mr1373_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706732811	NA	7.68E-06	mr1397_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706732811	NA	3.25E-07	mr1646_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706732811	5.25E-06	5.25E-06	mr1663_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706732811	1.03E-06	3.02E-07	mr1665_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706732811	8.41E-06	8.41E-06	mr1687_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706732811	NA	4.69E-07	mr1738_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706732811	NA	5.37E-07	mr1798_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251