Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0706732370:

Variant ID: vg0706732370 (JBrowse)	Variation Type: SNP
Chromosome: chr07	Position: 6732370
Reference Allele: T	Alternative Allele: G
Primary Allele: G	Secondary Allele: T

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.63, G: 0.38, others allele: 0.00, population size: 90. )

Flanking Sequence (100 bp) in Reference Genome:

GCTATGAATATATATAGTCTTGTTGTTAACATATATTTCGATCTAAGTGATTTATACTGTCTCGGCATGGCGCCCGATCTATCCCAGTCACTTGATTTAA[T/G]
TATATATCGACATAAGGATTATATATTGTTAATGTCTACAGCCGATCTAGTAGATTTAGTTCCTTTGAAATTCATTTATAACTGCCGATCGATGTATATA

Reverse complement sequence

TATATACATCGATCGGCAGTTATAAATGAATTTCAAAGGAACTAAATCTACTAGATCGGCTGTAGACATTAACAATATATAATCCTTATGTCGATATATA[A/C]
TTAAATCAAGTGACTGGGATAGATCGGGCGCCATGCCGAGACAGTATAAATCACTTAGATCGAAATATATGTTAACAACAAGACTATATATATTCATAGC

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	61.00%	33.20%	0.49%	5.27%	NA
All Indica	2759	94.30%	2.10%	0.22%	3.30%	NA
All Japonica	1512	0.50%	90.40%	0.99%	8.07%	NA
Aus	269	85.10%	4.50%	0.00%	10.41%	NA
Indica I	595	95.00%	1.00%	0.34%	3.70%	NA
Indica II	465	94.60%	4.50%	0.22%	0.65%	NA
Indica III	913	96.90%	0.70%	0.11%	2.30%	NA
Indica Intermediate	786	90.70%	3.30%	0.25%	5.73%	NA
Temperate Japonica	767	0.40%	82.80%	1.83%	14.99%	NA
Tropical Japonica	504	0.40%	99.40%	0.00%	0.20%	NA
Japonica Intermediate	241	1.20%	95.90%	0.41%	2.49%	NA
VI/Aromatic	96	3.10%	91.70%	0.00%	5.21%	NA
Intermediate	90	46.70%	47.80%	2.22%	3.33%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0706732370	T -> DEL	N	N	silent_mutation	Average:32.238; most accessible tissue: Zhenshan97 flag leaf, score: 43.728	N	N	N	N
vg0706732370	T -> G	LOC_Os07g12050.1	upstream_gene_variant ; 2606.0bp to feature; MODIFIER	silent_mutation	Average:32.238; most accessible tissue: Zhenshan97 flag leaf, score: 43.728	N	N	N	N
vg0706732370	T -> G	LOC_Os07g12060.1	upstream_gene_variant ; 355.0bp to feature; MODIFIER	silent_mutation	Average:32.238; most accessible tissue: Zhenshan97 flag leaf, score: 43.728	N	N	N	N
vg0706732370	T -> G	LOC_Os07g12050-LOC_Os07g12060	intergenic_region ; MODIFIER	silent_mutation	Average:32.238; most accessible tissue: Zhenshan97 flag leaf, score: 43.728	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0706732370	NA	9.75E-39	mr1082	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706732370	NA	2.39E-30	mr1085	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706732370	NA	4.52E-61	mr1103	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706732370	NA	7.14E-32	mr1107	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706732370	NA	5.64E-28	mr1145	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706732370	NA	2.62E-21	mr1155	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706732370	NA	7.45E-13	mr1170	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706732370	NA	2.54E-29	mr1226	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706732370	NA	1.10E-63	mr1246	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706732370	NA	1.74E-24	mr1411	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706732370	NA	6.09E-28	mr1436	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706732370	NA	4.35E-20	mr1541	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706732370	NA	1.92E-44	mr1563	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706732370	NA	7.18E-44	mr1591	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706732370	NA	6.99E-33	mr1733	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706732370	NA	9.42E-52	mr1795	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706732370	NA	3.05E-57	mr1064_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706732370	NA	1.77E-49	mr1070_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706732370	NA	1.07E-38	mr1082_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706732370	NA	1.80E-34	mr1083_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706732370	NA	1.39E-34	mr1085_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706732370	NA	9.46E-78	mr1088_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706732370	NA	5.74E-75	mr1103_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706732370	NA	1.01E-38	mr1104_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706732370	NA	1.56E-38	mr1107_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706732370	NA	3.77E-47	mr1145_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706732370	NA	5.89E-38	mr1155_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706732370	NA	9.18E-07	mr1212_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706732370	NA	2.65E-11	mr1216_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706732370	NA	4.21E-41	mr1226_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706732370	NA	8.48E-26	mr1233_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706732370	NA	2.02E-80	mr1246_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706732370	NA	7.57E-43	mr1264_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706732370	NA	1.27E-07	mr1335_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706732370	NA	1.84E-51	mr1404_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706732370	NA	5.87E-49	mr1437_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706732370	NA	6.39E-23	mr1609_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706732370	NA	5.78E-50	mr1620_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706732370	NA	1.78E-80	mr1671_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706732370	NA	9.82E-86	mr1795_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706732370	NA	1.57E-37	mr1878_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706732370	NA	3.43E-06	mr1915_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706732370	NA	7.21E-25	mr1916_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706732370	NA	4.98E-09	mr1947_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706732370	NA	2.98E-23	mr1949_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251