\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0706732370:

Variant ID: vg0706732370 (JBrowse)Variation Type: SNP
Chromosome: chr07Position: 6732370
Reference Allele: TAlternative Allele: G
Primary Allele: GSecondary Allele: T

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.63, G: 0.38, others allele: 0.00, population size: 90. )

Flanking Sequence (100 bp) in Reference Genome:


GCTATGAATATATATAGTCTTGTTGTTAACATATATTTCGATCTAAGTGATTTATACTGTCTCGGCATGGCGCCCGATCTATCCCAGTCACTTGATTTAA[T/G]
TATATATCGACATAAGGATTATATATTGTTAATGTCTACAGCCGATCTAGTAGATTTAGTTCCTTTGAAATTCATTTATAACTGCCGATCGATGTATATA

Reverse complement sequence

TATATACATCGATCGGCAGTTATAAATGAATTTCAAAGGAACTAAATCTACTAGATCGGCTGTAGACATTAACAATATATAATCCTTATGTCGATATATA[A/C]
TTAAATCAAGTGACTGGGATAGATCGGGCGCCATGCCGAGACAGTATAAATCACTTAGATCGAAATATATGTTAACAACAAGACTATATATATTCATAGC

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 61.00% 33.20% 0.49% 5.27% NA
All Indica  2759 94.30% 2.10% 0.22% 3.30% NA
All Japonica  1512 0.50% 90.40% 0.99% 8.07% NA
Aus  269 85.10% 4.50% 0.00% 10.41% NA
Indica I  595 95.00% 1.00% 0.34% 3.70% NA
Indica II  465 94.60% 4.50% 0.22% 0.65% NA
Indica III  913 96.90% 0.70% 0.11% 2.30% NA
Indica Intermediate  786 90.70% 3.30% 0.25% 5.73% NA
Temperate Japonica  767 0.40% 82.80% 1.83% 14.99% NA
Tropical Japonica  504 0.40% 99.40% 0.00% 0.20% NA
Japonica Intermediate  241 1.20% 95.90% 0.41% 2.49% NA
VI/Aromatic  96 3.10% 91.70% 0.00% 5.21% NA
Intermediate  90 46.70% 47.80% 2.22% 3.33% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0706732370 T -> DEL N N silent_mutation Average:32.238; most accessible tissue: Zhenshan97 flag leaf, score: 43.728 N N N N
vg0706732370 T -> G LOC_Os07g12050.1 upstream_gene_variant ; 2606.0bp to feature; MODIFIER silent_mutation Average:32.238; most accessible tissue: Zhenshan97 flag leaf, score: 43.728 N N N N
vg0706732370 T -> G LOC_Os07g12060.1 upstream_gene_variant ; 355.0bp to feature; MODIFIER silent_mutation Average:32.238; most accessible tissue: Zhenshan97 flag leaf, score: 43.728 N N N N
vg0706732370 T -> G LOC_Os07g12050-LOC_Os07g12060 intergenic_region ; MODIFIER silent_mutation Average:32.238; most accessible tissue: Zhenshan97 flag leaf, score: 43.728 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0706732370 NA 9.75E-39 mr1082 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706732370 NA 2.39E-30 mr1085 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706732370 NA 4.52E-61 mr1103 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706732370 NA 7.14E-32 mr1107 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706732370 NA 5.64E-28 mr1145 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706732370 NA 2.62E-21 mr1155 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706732370 NA 7.45E-13 mr1170 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706732370 NA 2.54E-29 mr1226 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706732370 NA 1.10E-63 mr1246 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706732370 NA 1.74E-24 mr1411 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706732370 NA 6.09E-28 mr1436 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706732370 NA 4.35E-20 mr1541 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706732370 NA 1.92E-44 mr1563 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706732370 NA 7.18E-44 mr1591 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706732370 NA 6.99E-33 mr1733 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706732370 NA 9.42E-52 mr1795 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706732370 NA 3.05E-57 mr1064_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706732370 NA 1.77E-49 mr1070_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706732370 NA 1.07E-38 mr1082_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706732370 NA 1.80E-34 mr1083_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706732370 NA 1.39E-34 mr1085_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706732370 NA 9.46E-78 mr1088_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706732370 NA 5.74E-75 mr1103_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706732370 NA 1.01E-38 mr1104_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706732370 NA 1.56E-38 mr1107_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706732370 NA 3.77E-47 mr1145_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706732370 NA 5.89E-38 mr1155_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706732370 NA 9.18E-07 mr1212_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706732370 NA 2.65E-11 mr1216_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706732370 NA 4.21E-41 mr1226_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706732370 NA 8.48E-26 mr1233_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706732370 NA 2.02E-80 mr1246_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706732370 NA 7.57E-43 mr1264_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706732370 NA 1.27E-07 mr1335_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706732370 NA 1.84E-51 mr1404_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706732370 NA 5.87E-49 mr1437_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706732370 NA 6.39E-23 mr1609_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706732370 NA 5.78E-50 mr1620_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706732370 NA 1.78E-80 mr1671_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706732370 NA 9.82E-86 mr1795_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706732370 NA 1.57E-37 mr1878_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706732370 NA 3.43E-06 mr1915_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706732370 NA 7.21E-25 mr1916_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706732370 NA 4.98E-09 mr1947_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706732370 NA 2.98E-23 mr1949_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251