\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0706728204:

Variant ID: vg0706728204 (JBrowse)Variation Type: SNP
Chromosome: chr07Position: 6728204
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


AAATTTGAATTTGAATTCAAATATTTTCTATATATAGTATTTCTATACATCTAAAGTTTATAGACCTAAAGTTTATAGACCCAAAGTTTATAAGTCAAAA[G/A]
TTTACATACCCGATTTAAATTTGAATTTGAATTCAAATTTTTTATATATAGTATTTCTATACATAAATTTTTCTAACTTTTTGTTTTTTTAAAAAAAATT

Reverse complement sequence

AATTTTTTTTAAAAAAACAAAAAGTTAGAAAAATTTATGTATAGAAATACTATATATAAAAAATTTGAATTCAAATTCAAATTTAAATCGGGTATGTAAA[C/T]
TTTTGACTTATAAACTTTGGGTCTATAAACTTTAGGTCTATAAACTTTAGATGTATAGAAATACTATATATAGAAAATATTTGAATTCAAATTCAAATTT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 90.20% 7.00% 0.59% 2.14% NA
All Indica  2759 96.70% 0.10% 0.18% 3.08% NA
All Japonica  1512 77.10% 21.30% 1.46% 0.13% NA
Aus  269 95.90% 0.00% 0.00% 4.09% NA
Indica I  595 95.60% 0.00% 0.50% 3.87% NA
Indica II  465 99.80% 0.00% 0.00% 0.22% NA
Indica III  913 97.90% 0.00% 0.11% 1.97% NA
Indica Intermediate  786 94.10% 0.30% 0.13% 5.47% NA
Temperate Japonica  767 98.30% 1.00% 0.52% 0.13% NA
Tropical Japonica  504 37.10% 60.50% 2.38% 0.00% NA
Japonica Intermediate  241 93.40% 3.70% 2.49% 0.41% NA
VI/Aromatic  96 96.90% 0.00% 0.00% 3.12% NA
Intermediate  90 88.90% 10.00% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0706728204 G -> DEL N N silent_mutation Average:31.972; most accessible tissue: Callus, score: 45.137 N N N N
vg0706728204 G -> A LOC_Os07g12040.1 upstream_gene_variant ; 1408.0bp to feature; MODIFIER silent_mutation Average:31.972; most accessible tissue: Callus, score: 45.137 N N N N
vg0706728204 G -> A LOC_Os07g12060.1 upstream_gene_variant ; 4521.0bp to feature; MODIFIER silent_mutation Average:31.972; most accessible tissue: Callus, score: 45.137 N N N N
vg0706728204 G -> A LOC_Os07g12050.1 downstream_gene_variant ; 879.0bp to feature; MODIFIER silent_mutation Average:31.972; most accessible tissue: Callus, score: 45.137 N N N N
vg0706728204 G -> A LOC_Os07g12040-LOC_Os07g12050 intergenic_region ; MODIFIER silent_mutation Average:31.972; most accessible tissue: Callus, score: 45.137 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0706728204 NA 1.33E-06 mr1248 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706728204 NA 1.29E-06 mr1338 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706728204 3.55E-06 1.32E-15 mr1871 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706728204 NA 5.77E-07 mr1871 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706728204 5.92E-07 1.02E-21 mr1042_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706728204 NA 7.92E-08 mr1042_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706728204 NA 1.82E-07 mr1047_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706728204 NA 7.55E-12 mr1097_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706728204 NA 5.90E-10 mr1125_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706728204 NA 2.71E-06 mr1295_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706728204 NA 4.63E-08 mr1304_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706728204 NA 9.88E-06 mr1319_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706728204 NA 6.32E-08 mr1363_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706728204 NA 9.26E-06 mr1397_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706728204 NA 5.62E-06 mr1405_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706728204 NA 1.52E-11 mr1471_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706728204 NA 1.24E-08 mr1502_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706728204 6.86E-06 1.26E-11 mr1543_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706728204 NA 1.64E-10 mr1543_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706728204 NA 3.46E-06 mr1553_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706728204 NA 5.59E-08 mr1642_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706728204 NA 1.57E-10 mr1642_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706728204 NA 5.42E-12 mr1680_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706728204 2.20E-07 4.80E-20 mr1742_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706728204 NA 2.82E-11 mr1742_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706728204 NA 2.71E-06 mr1782_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706728204 NA 8.96E-07 mr1786_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706728204 NA 5.57E-10 mr1817_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706728204 NA 1.39E-07 mr1819_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706728204 5.15E-08 5.95E-25 mr1871_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706728204 NA 1.68E-08 mr1871_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706728204 NA 1.32E-08 mr1966_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706728204 NA 2.10E-06 mr1966_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251