\
| Variant ID: vg0706707109 (JBrowse) | Variation Type: SNP |
| Chromosome: chr07 | Position: 6707109 |
| Reference Allele: T | Alternative Allele: G |
| Primary Allele: G | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
AAATTTGAAGTCAAAATTTGAAAACTTTGAAAATTTTGAACTCAAAATTTAAATTTGTAAGTCAAATTTAAAAACATTTAACTCAGATTTTAAAACTTTT[T/G]
ACTCAGATTTGAAAACTTTCAACTCGTTATTTCAAAACTTTTAACTCCAGATTTTAAAACATTCAAGTCAAGATTTGAAATTTTCAACTCTAGATTTGAA
TTCAAATCTAGAGTTGAAAATTTCAAATCTTGACTTGAATGTTTTAAAATCTGGAGTTAAAAGTTTTGAAATAACGAGTTGAAAGTTTTCAAATCTGAGT[A/C]
AAAAGTTTTAAAATCTGAGTTAAATGTTTTTAAATTTGACTTACAAATTTAAATTTTGAGTTCAAAATTTTCAAAGTTTTCAAATTTTGACTTCAAATTT
| Populations | Population Size | Frequency of G(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 63.80% | 34.10% | 0.34% | 1.78% | NA |
| All Indica | 2759 | 94.50% | 2.50% | 0.40% | 2.61% | NA |
| All Japonica | 1512 | 7.90% | 92.10% | 0.00% | 0.00% | NA |
| Aus | 269 | 90.30% | 5.20% | 0.74% | 3.72% | NA |
| Indica I | 595 | 95.50% | 1.00% | 0.34% | 3.19% | NA |
| Indica II | 465 | 94.60% | 4.90% | 0.43% | 0.00% | NA |
| Indica III | 913 | 97.30% | 0.80% | 0.11% | 1.86% | NA |
| Indica Intermediate | 786 | 90.50% | 4.20% | 0.76% | 4.58% | NA |
| Temperate Japonica | 767 | 14.10% | 85.90% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 0.60% | 99.40% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 3.30% | 96.70% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 3.10% | 93.80% | 1.04% | 2.08% | NA |
| Intermediate | 90 | 47.80% | 50.00% | 2.22% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0706707109 | T -> DEL | N | N | silent_mutation | Average:14.125; most accessible tissue: Callus, score: 32.73 | N | N | N | N |
| vg0706707109 | T -> G | LOC_Os07g12020.1 | upstream_gene_variant ; 1894.0bp to feature; MODIFIER | silent_mutation | Average:14.125; most accessible tissue: Callus, score: 32.73 | N | N | N | N |
| vg0706707109 | T -> G | LOC_Os07g12010-LOC_Os07g12020 | intergenic_region ; MODIFIER | silent_mutation | Average:14.125; most accessible tissue: Callus, score: 32.73 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0706707109 | 4.66E-06 | 4.66E-06 | mr1036_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0706707109 | NA | 8.31E-28 | mr1238_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0706707109 | NA | 2.57E-07 | mr1408_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0706707109 | NA | 3.79E-23 | mr1609_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0706707109 | NA | 1.46E-31 | mr1841_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0706707109 | NA | 8.19E-20 | mr1900_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0706707109 | NA | 1.63E-24 | mr1916_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0706707109 | NA | 1.92E-18 | mr1945_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |