Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0706707109:

Variant ID: vg0706707109 (JBrowse)	Variation Type: SNP
Chromosome: chr07	Position: 6707109
Reference Allele: T	Alternative Allele: G
Primary Allele: G	Secondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

AAATTTGAAGTCAAAATTTGAAAACTTTGAAAATTTTGAACTCAAAATTTAAATTTGTAAGTCAAATTTAAAAACATTTAACTCAGATTTTAAAACTTTT[T/G]
ACTCAGATTTGAAAACTTTCAACTCGTTATTTCAAAACTTTTAACTCCAGATTTTAAAACATTCAAGTCAAGATTTGAAATTTTCAACTCTAGATTTGAA

Reverse complement sequence

TTCAAATCTAGAGTTGAAAATTTCAAATCTTGACTTGAATGTTTTAAAATCTGGAGTTAAAAGTTTTGAAATAACGAGTTGAAAGTTTTCAAATCTGAGT[A/C]
AAAAGTTTTAAAATCTGAGTTAAATGTTTTTAAATTTGACTTACAAATTTAAATTTTGAGTTCAAAATTTTCAAAGTTTTCAAATTTTGACTTCAAATTT

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	63.80%	34.10%	0.34%	1.78%	NA
All Indica	2759	94.50%	2.50%	0.40%	2.61%	NA
All Japonica	1512	7.90%	92.10%	0.00%	0.00%	NA
Aus	269	90.30%	5.20%	0.74%	3.72%	NA
Indica I	595	95.50%	1.00%	0.34%	3.19%	NA
Indica II	465	94.60%	4.90%	0.43%	0.00%	NA
Indica III	913	97.30%	0.80%	0.11%	1.86%	NA
Indica Intermediate	786	90.50%	4.20%	0.76%	4.58%	NA
Temperate Japonica	767	14.10%	85.90%	0.00%	0.00%	NA
Tropical Japonica	504	0.60%	99.40%	0.00%	0.00%	NA
Japonica Intermediate	241	3.30%	96.70%	0.00%	0.00%	NA
VI/Aromatic	96	3.10%	93.80%	1.04%	2.08%	NA
Intermediate	90	47.80%	50.00%	2.22%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0706707109	T -> DEL	N	N	silent_mutation	Average:14.125; most accessible tissue: Callus, score: 32.73	N	N	N	N
vg0706707109	T -> G	LOC_Os07g12020.1	upstream_gene_variant ; 1894.0bp to feature; MODIFIER	silent_mutation	Average:14.125; most accessible tissue: Callus, score: 32.73	N	N	N	N
vg0706707109	T -> G	LOC_Os07g12010-LOC_Os07g12020	intergenic_region ; MODIFIER	silent_mutation	Average:14.125; most accessible tissue: Callus, score: 32.73	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0706707109	4.66E-06	4.66E-06	mr1036_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706707109	NA	8.31E-28	mr1238_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706707109	NA	2.57E-07	mr1408_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706707109	NA	3.79E-23	mr1609_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706707109	NA	1.46E-31	mr1841_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706707109	NA	8.19E-20	mr1900_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706707109	NA	1.63E-24	mr1916_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706707109	NA	1.92E-18	mr1945_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251