\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0706707109:

Variant ID: vg0706707109 (JBrowse)Variation Type: SNP
Chromosome: chr07Position: 6707109
Reference Allele: TAlternative Allele: G
Primary Allele: GSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


AAATTTGAAGTCAAAATTTGAAAACTTTGAAAATTTTGAACTCAAAATTTAAATTTGTAAGTCAAATTTAAAAACATTTAACTCAGATTTTAAAACTTTT[T/G]
ACTCAGATTTGAAAACTTTCAACTCGTTATTTCAAAACTTTTAACTCCAGATTTTAAAACATTCAAGTCAAGATTTGAAATTTTCAACTCTAGATTTGAA

Reverse complement sequence

TTCAAATCTAGAGTTGAAAATTTCAAATCTTGACTTGAATGTTTTAAAATCTGGAGTTAAAAGTTTTGAAATAACGAGTTGAAAGTTTTCAAATCTGAGT[A/C]
AAAAGTTTTAAAATCTGAGTTAAATGTTTTTAAATTTGACTTACAAATTTAAATTTTGAGTTCAAAATTTTCAAAGTTTTCAAATTTTGACTTCAAATTT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 63.80% 34.10% 0.34% 1.78% NA
All Indica  2759 94.50% 2.50% 0.40% 2.61% NA
All Japonica  1512 7.90% 92.10% 0.00% 0.00% NA
Aus  269 90.30% 5.20% 0.74% 3.72% NA
Indica I  595 95.50% 1.00% 0.34% 3.19% NA
Indica II  465 94.60% 4.90% 0.43% 0.00% NA
Indica III  913 97.30% 0.80% 0.11% 1.86% NA
Indica Intermediate  786 90.50% 4.20% 0.76% 4.58% NA
Temperate Japonica  767 14.10% 85.90% 0.00% 0.00% NA
Tropical Japonica  504 0.60% 99.40% 0.00% 0.00% NA
Japonica Intermediate  241 3.30% 96.70% 0.00% 0.00% NA
VI/Aromatic  96 3.10% 93.80% 1.04% 2.08% NA
Intermediate  90 47.80% 50.00% 2.22% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0706707109 T -> DEL N N silent_mutation Average:14.125; most accessible tissue: Callus, score: 32.73 N N N N
vg0706707109 T -> G LOC_Os07g12020.1 upstream_gene_variant ; 1894.0bp to feature; MODIFIER silent_mutation Average:14.125; most accessible tissue: Callus, score: 32.73 N N N N
vg0706707109 T -> G LOC_Os07g12010-LOC_Os07g12020 intergenic_region ; MODIFIER silent_mutation Average:14.125; most accessible tissue: Callus, score: 32.73 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0706707109 4.66E-06 4.66E-06 mr1036_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706707109 NA 8.31E-28 mr1238_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706707109 NA 2.57E-07 mr1408_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706707109 NA 3.79E-23 mr1609_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706707109 NA 1.46E-31 mr1841_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706707109 NA 8.19E-20 mr1900_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706707109 NA 1.63E-24 mr1916_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706707109 NA 1.92E-18 mr1945_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251