\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0706671410:

Variant ID: vg0706671410 (JBrowse)Variation Type: SNP
Chromosome: chr07Position: 6671410
Reference Allele: TAlternative Allele: A
Primary Allele: ASecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CCGGCGGCGTGTCTTGGCGTATGTAGGCTTGTATGTTGTGGCTTCTGGTGGGCGTGTGTTGATTGTCATGGGTGTCTTCCATGGTTCCTCTCTCCTGTCC[T/A]
TCTAGGGGGGCTTGTATTTATATCCATAGGTGTCCCCTTATACAAGTAGAACTAGAGAAACCAATATGGATACAATCCGAGTAGTCCTTGTCGTTTCCAT

Reverse complement sequence

ATGGAAACGACAAGGACTACTCGGATTGTATCCATATTGGTTTCTCTAGTTCTACTTGTATAAGGGGACACCTATGGATATAAATACAAGCCCCCCTAGA[A/T]
GGACAGGAGAGAGGAACCATGGAAGACACCCATGACAATCAACACACGCCCACCAGAAGCCACAACATACAAGCCTACATACGCCAAGACACGCCGCCGG

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 44.20% 40.90% 7.28% 7.58% NA
All Indica  2759 69.50% 7.00% 11.20% 12.32% NA
All Japonica  1512 6.50% 92.30% 0.40% 0.73% NA
Aus  269 17.50% 73.60% 8.18% 0.74% NA
Indica I  595 69.60% 5.40% 14.96% 10.08% NA
Indica II  465 73.10% 8.60% 9.89% 8.39% NA
Indica III  913 72.30% 3.70% 10.08% 13.91% NA
Indica Intermediate  786 64.00% 11.10% 10.43% 14.50% NA
Temperate Japonica  767 11.90% 86.30% 0.65% 1.17% NA
Tropical Japonica  504 0.40% 99.40% 0.00% 0.20% NA
Japonica Intermediate  241 2.50% 96.70% 0.41% 0.41% NA
VI/Aromatic  96 0.00% 96.90% 0.00% 3.12% NA
Intermediate  90 28.90% 61.10% 7.78% 2.22% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0706671410 T -> DEL N N silent_mutation Average:40.295; most accessible tissue: Minghui63 young leaf, score: 56.213 N N N N
vg0706671410 T -> A LOC_Os07g12010.1 upstream_gene_variant ; 19.0bp to feature; MODIFIER silent_mutation Average:40.295; most accessible tissue: Minghui63 young leaf, score: 56.213 N N N N
vg0706671410 T -> A LOC_Os07g12010-LOC_Os07g12020 intergenic_region ; MODIFIER silent_mutation Average:40.295; most accessible tissue: Minghui63 young leaf, score: 56.213 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0706671410 7.79E-06 NA mr1016 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706671410 4.61E-06 2.02E-06 mr1018 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706671410 9.62E-06 NA mr1067 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706671410 7.57E-06 NA mr1071 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706671410 5.99E-06 NA mr1080 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706671410 4.17E-06 NA mr1087 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706671410 4.87E-06 2.35E-06 mr1100 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706671410 NA 4.97E-07 mr1103 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706671410 5.45E-07 NA mr1132 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706671410 2.92E-07 4.15E-07 mr1140 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706671410 2.58E-06 NA mr1142 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706671410 NA 2.97E-06 mr1176 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706671410 NA 4.08E-27 mr1181 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706671410 NA 1.26E-11 mr1195 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706671410 9.23E-06 NA mr1203 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706671410 1.10E-09 8.26E-09 mr1203 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706671410 2.28E-06 2.28E-06 mr1248 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706671410 NA 2.42E-11 mr1281 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706671410 6.46E-08 2.08E-08 mr1395 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706671410 NA 2.15E-06 mr1398 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706671410 NA 2.60E-30 mr1426 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706671410 4.49E-06 NA mr1458 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706671410 2.69E-07 6.89E-08 mr1489 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706671410 NA 1.07E-09 mr1524 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706671410 NA 5.61E-11 mr1609 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706671410 6.86E-06 NA mr1613 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706671410 8.16E-08 1.78E-07 mr1618 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706671410 NA 6.23E-14 mr1655 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706671410 NA 9.91E-12 mr1657 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706671410 NA 7.52E-16 mr1700 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706671410 NA 7.56E-10 mr1712 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706671410 NA 2.59E-07 mr1717 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706671410 NA 3.50E-09 mr1827 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706671410 NA 1.28E-13 mr1666_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706671410 NA 1.04E-10 mr1761_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251