\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0706644677:

Variant ID: vg0706644677 (JBrowse)Variation Type: SNP
Chromosome: chr07Position: 6644677
Reference Allele: AAlternative Allele: G
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.62, A: 0.38, others allele: 0.00, population size: 84. )

Flanking Sequence (100 bp) in Reference Genome:


TACACCATGAACAAAAGTTCCAGATCATATAAATTCGACTAACACAGTGGCACTTCATCCGCGGCAACGCACGGGGTCCTGGCTAGTTATATATCTATTT[A/G]
GGGCAGGAGGAATGGAAGGACATGAAAGAAAACATGTCTGCTATGAATCTTTGTGGAAATGGAACTAAGATGAACAACTCTGATGTGAGTCACTCTGAAG

Reverse complement sequence

CTTCAGAGTGACTCACATCAGAGTTGTTCATCTTAGTTCCATTTCCACAAAGATTCATAGCAGACATGTTTTCTTTCATGTCCTTCCATTCCTCCTGCCC[T/C]
AAATAGATATATAACTAGCCAGGACCCCGTGCGTTGCCGCGGATGAAGTGCCACTGTGTTAGTCGAATTTATATGATCTGGAACTTTTGTTCATGGTGTA

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 37.20% 17.20% 0.30% 45.28% NA
All Indica  2759 7.30% 20.30% 0.47% 71.91% NA
All Japonica  1512 93.00% 0.10% 0.00% 6.94% NA
Aus  269 3.30% 87.00% 0.00% 9.67% NA
Indica I  595 9.70% 22.40% 0.17% 67.73% NA
Indica II  465 12.70% 4.90% 0.65% 81.72% NA
Indica III  913 2.00% 23.80% 0.33% 73.93% NA
Indica Intermediate  786 8.40% 23.90% 0.76% 66.92% NA
Temperate Japonica  767 87.50% 0.10% 0.00% 12.39% NA
Tropical Japonica  504 99.60% 0.00% 0.00% 0.40% NA
Japonica Intermediate  241 96.70% 0.00% 0.00% 3.32% NA
VI/Aromatic  96 93.80% 3.10% 0.00% 3.12% NA
Intermediate  90 58.90% 15.60% 1.11% 24.44% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0706644677 A -> DEL N N silent_mutation Average:13.254; most accessible tissue: Callus, score: 40.913 N N N N
vg0706644677 A -> G LOC_Os07g11980.1 upstream_gene_variant ; 1601.0bp to feature; MODIFIER silent_mutation Average:13.254; most accessible tissue: Callus, score: 40.913 N N N N
vg0706644677 A -> G LOC_Os07g11990.1 downstream_gene_variant ; 2560.0bp to feature; MODIFIER silent_mutation Average:13.254; most accessible tissue: Callus, score: 40.913 N N N N
vg0706644677 A -> G LOC_Os07g11980-LOC_Os07g11990 intergenic_region ; MODIFIER silent_mutation Average:13.254; most accessible tissue: Callus, score: 40.913 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0706644677 NA 2.13E-07 mr1063 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706644677 NA 1.50E-06 mr1177 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706644677 NA 7.23E-08 mr1177 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706644677 NA 8.38E-07 mr1215 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706644677 NA 3.30E-08 mr1220 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706644677 NA 2.23E-06 mr1221 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706644677 6.87E-06 NA mr1253 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706644677 NA 7.02E-06 mr1289 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706644677 NA 1.41E-07 mr1343 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706644677 NA 7.19E-08 mr1352 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706644677 6.33E-08 6.33E-08 mr1360 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706644677 NA 2.47E-06 mr1422 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706644677 NA 9.29E-06 mr1670 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706644677 NA 5.18E-08 mr1739 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706644677 NA 2.16E-07 mr1740 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706644677 NA 5.85E-06 mr1741 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706644677 NA 7.84E-06 mr1800 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706644677 NA 1.04E-06 mr1806 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706644677 7.35E-06 7.35E-06 mr1945 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706644677 NA 3.14E-06 mr1528_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706644677 NA 5.18E-06 mr1740_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251