\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0706614349:

Variant ID: vg0706614349 (JBrowse)Variation Type: SNP
Chromosome: chr07Position: 6614349
Reference Allele: TAlternative Allele: A,C
Primary Allele: TSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GAAGTCTAATATCACCATTCGAGATATTTACGAGAGATCACCATTATAATTTTGCTGAAACATGAGGTTTATTATCCATTTTGTTTACAGTGAGACTATC[T/A,C]
ACTTTCAATGCTAGAATAAACTACTCAAAGCAACGAGTTTGTCAGCAAGAACAACCTCAATGTCTTGGAGCATTCCTTAAGTACGACATCACATAATTTT

Reverse complement sequence

AAAATTATGTGATGTCGTACTTAAGGAATGCTCCAAGACATTGAGGTTGTTCTTGCTGACAAACTCGTTGCTTTGAGTAGTTTATTCTAGCATTGAAAGT[A/T,G]
GATAGTCTCACTGTAAACAAAATGGATAATAAACCTCATGTTTCAGCAAAATTATAATGGTGATCTCTCGTAAATATCTCGAATGGTGATATTAGACTTC

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 39.50% 0.40% 15.23% 44.77% C: 0.04%
All Indica  2759 10.10% 0.70% 17.72% 71.40% C: 0.07%
All Japonica  1512 93.10% 0.00% 0.20% 6.68% NA
Aus  269 13.00% 0.70% 78.44% 7.81% NA
Indica I  595 13.60% 0.70% 19.50% 65.88% C: 0.34%
Indica II  465 13.80% 0.40% 4.73% 81.08% NA
Indica III  913 3.80% 0.50% 20.26% 75.36% NA
Indica Intermediate  786 12.60% 1.00% 21.12% 65.27% NA
Temperate Japonica  767 87.70% 0.00% 0.26% 11.99% NA
Tropical Japonica  504 99.40% 0.00% 0.00% 0.60% NA
Japonica Intermediate  241 97.10% 0.00% 0.41% 2.49% NA
VI/Aromatic  96 93.80% 0.00% 5.21% 1.04% NA
Intermediate  90 61.10% 0.00% 13.33% 25.56% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0706614349 T -> DEL N N silent_mutation Average:7.242; most accessible tissue: Callus, score: 28.324 N N N N
vg0706614349 T -> A LOC_Os07g11900.1 upstream_gene_variant ; 4660.0bp to feature; MODIFIER silent_mutation Average:7.242; most accessible tissue: Callus, score: 28.324 N N N N
vg0706614349 T -> A LOC_Os07g11910.1 upstream_gene_variant ; 2591.0bp to feature; MODIFIER silent_mutation Average:7.242; most accessible tissue: Callus, score: 28.324 N N N N
vg0706614349 T -> A LOC_Os07g11920.1 upstream_gene_variant ; 587.0bp to feature; MODIFIER silent_mutation Average:7.242; most accessible tissue: Callus, score: 28.324 N N N N
vg0706614349 T -> A LOC_Os07g11920-LOC_Os07g11970 intergenic_region ; MODIFIER silent_mutation Average:7.242; most accessible tissue: Callus, score: 28.324 N N N N
vg0706614349 T -> C LOC_Os07g11900.1 upstream_gene_variant ; 4660.0bp to feature; MODIFIER silent_mutation Average:7.242; most accessible tissue: Callus, score: 28.324 N N N N
vg0706614349 T -> C LOC_Os07g11910.1 upstream_gene_variant ; 2591.0bp to feature; MODIFIER silent_mutation Average:7.242; most accessible tissue: Callus, score: 28.324 N N N N
vg0706614349 T -> C LOC_Os07g11920.1 upstream_gene_variant ; 587.0bp to feature; MODIFIER silent_mutation Average:7.242; most accessible tissue: Callus, score: 28.324 N N N N
vg0706614349 T -> C LOC_Os07g11920-LOC_Os07g11970 intergenic_region ; MODIFIER silent_mutation Average:7.242; most accessible tissue: Callus, score: 28.324 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0706614349 NA 3.77E-10 mr1715 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706614349 NA 4.34E-06 mr1721 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706614349 NA 3.65E-07 mr1771 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706614349 NA 6.66E-06 mr1721_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706614349 NA 1.58E-09 mr1739_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706614349 NA 1.00E-08 mr1739_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251