\
| Variant ID: vg0706614349 (JBrowse) | Variation Type: SNP |
| Chromosome: chr07 | Position: 6614349 |
| Reference Allele: T | Alternative Allele: A,C |
| Primary Allele: T | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
GAAGTCTAATATCACCATTCGAGATATTTACGAGAGATCACCATTATAATTTTGCTGAAACATGAGGTTTATTATCCATTTTGTTTACAGTGAGACTATC[T/A,C]
ACTTTCAATGCTAGAATAAACTACTCAAAGCAACGAGTTTGTCAGCAAGAACAACCTCAATGTCTTGGAGCATTCCTTAAGTACGACATCACATAATTTT
AAAATTATGTGATGTCGTACTTAAGGAATGCTCCAAGACATTGAGGTTGTTCTTGCTGACAAACTCGTTGCTTTGAGTAGTTTATTCTAGCATTGAAAGT[A/T,G]
GATAGTCTCACTGTAAACAAAATGGATAATAAACCTCATGTTTCAGCAAAATTATAATGGTGATCTCTCGTAAATATCTCGAATGGTGATATTAGACTTC
| Populations | Population Size | Frequency of T(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 39.50% | 0.40% | 15.23% | 44.77% | C: 0.04% |
| All Indica | 2759 | 10.10% | 0.70% | 17.72% | 71.40% | C: 0.07% |
| All Japonica | 1512 | 93.10% | 0.00% | 0.20% | 6.68% | NA |
| Aus | 269 | 13.00% | 0.70% | 78.44% | 7.81% | NA |
| Indica I | 595 | 13.60% | 0.70% | 19.50% | 65.88% | C: 0.34% |
| Indica II | 465 | 13.80% | 0.40% | 4.73% | 81.08% | NA |
| Indica III | 913 | 3.80% | 0.50% | 20.26% | 75.36% | NA |
| Indica Intermediate | 786 | 12.60% | 1.00% | 21.12% | 65.27% | NA |
| Temperate Japonica | 767 | 87.70% | 0.00% | 0.26% | 11.99% | NA |
| Tropical Japonica | 504 | 99.40% | 0.00% | 0.00% | 0.60% | NA |
| Japonica Intermediate | 241 | 97.10% | 0.00% | 0.41% | 2.49% | NA |
| VI/Aromatic | 96 | 93.80% | 0.00% | 5.21% | 1.04% | NA |
| Intermediate | 90 | 61.10% | 0.00% | 13.33% | 25.56% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0706614349 | T -> DEL | N | N | silent_mutation | Average:7.242; most accessible tissue: Callus, score: 28.324 | N | N | N | N |
| vg0706614349 | T -> A | LOC_Os07g11900.1 | upstream_gene_variant ; 4660.0bp to feature; MODIFIER | silent_mutation | Average:7.242; most accessible tissue: Callus, score: 28.324 | N | N | N | N |
| vg0706614349 | T -> A | LOC_Os07g11910.1 | upstream_gene_variant ; 2591.0bp to feature; MODIFIER | silent_mutation | Average:7.242; most accessible tissue: Callus, score: 28.324 | N | N | N | N |
| vg0706614349 | T -> A | LOC_Os07g11920.1 | upstream_gene_variant ; 587.0bp to feature; MODIFIER | silent_mutation | Average:7.242; most accessible tissue: Callus, score: 28.324 | N | N | N | N |
| vg0706614349 | T -> A | LOC_Os07g11920-LOC_Os07g11970 | intergenic_region ; MODIFIER | silent_mutation | Average:7.242; most accessible tissue: Callus, score: 28.324 | N | N | N | N |
| vg0706614349 | T -> C | LOC_Os07g11900.1 | upstream_gene_variant ; 4660.0bp to feature; MODIFIER | silent_mutation | Average:7.242; most accessible tissue: Callus, score: 28.324 | N | N | N | N |
| vg0706614349 | T -> C | LOC_Os07g11910.1 | upstream_gene_variant ; 2591.0bp to feature; MODIFIER | silent_mutation | Average:7.242; most accessible tissue: Callus, score: 28.324 | N | N | N | N |
| vg0706614349 | T -> C | LOC_Os07g11920.1 | upstream_gene_variant ; 587.0bp to feature; MODIFIER | silent_mutation | Average:7.242; most accessible tissue: Callus, score: 28.324 | N | N | N | N |
| vg0706614349 | T -> C | LOC_Os07g11920-LOC_Os07g11970 | intergenic_region ; MODIFIER | silent_mutation | Average:7.242; most accessible tissue: Callus, score: 28.324 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0706614349 | NA | 3.77E-10 | mr1715 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0706614349 | NA | 4.34E-06 | mr1721 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0706614349 | NA | 3.65E-07 | mr1771 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0706614349 | NA | 6.66E-06 | mr1721_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0706614349 | NA | 1.58E-09 | mr1739_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0706614349 | NA | 1.00E-08 | mr1739_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |