\
| Variant ID: vg0706567686 (JBrowse) | Variation Type: SNP |
| Chromosome: chr07 | Position: 6567686 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: T | Secondary Allele: C |
Inferred Ancestral Allele: Not determined.
AGCTGAGAGTAAATCTTGTTTAGTGAAGAAAATAGTTAAGATTAAGATGAAAATCGTACCGAGTTTTGTAAACATAGTGTTTTTATTTTTGAAAGTATTA[T/C]
TAAATGGGAATTTCTCCCTTGGCCAACTTAGAAAAGGGGTGGGGCGCCTTTTTGGTCTTTTCCTACAGTCGTATGGCTCTGATACCAGCTTTGTGGACCC
GGGTCCACAAAGCTGGTATCAGAGCCATACGACTGTAGGAAAAGACCAAAAAGGCGCCCCACCCCTTTTCTAAGTTGGCCAAGGGAGAAATTCCCATTTA[A/G]
TAATACTTTCAAAAATAAAAACACTATGTTTACAAAACTCGGTACGATTTTCATCTTAATCTTAACTATTTTCTTCACTAAACAAGATTTACTCTCAGCT
| Populations | Population Size | Frequency of T(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 72.60% | 2.20% | 3.45% | 21.75% | NA |
| All Indica | 2759 | 59.00% | 3.40% | 5.15% | 32.44% | NA |
| All Japonica | 1512 | 98.70% | 0.00% | 0.07% | 1.26% | NA |
| Aus | 269 | 53.90% | 3.70% | 7.06% | 35.32% | NA |
| Indica I | 595 | 65.50% | 2.20% | 4.54% | 27.73% | NA |
| Indica II | 465 | 62.40% | 1.70% | 3.23% | 32.69% | NA |
| Indica III | 913 | 52.40% | 3.70% | 7.67% | 36.25% | NA |
| Indica Intermediate | 786 | 59.80% | 5.00% | 3.82% | 31.42% | NA |
| Temperate Japonica | 767 | 98.20% | 0.00% | 0.00% | 1.83% | NA |
| Tropical Japonica | 504 | 99.40% | 0.00% | 0.00% | 0.60% | NA |
| Japonica Intermediate | 241 | 98.80% | 0.00% | 0.41% | 0.83% | NA |
| VI/Aromatic | 96 | 97.90% | 1.00% | 0.00% | 1.04% | NA |
| Intermediate | 90 | 78.90% | 0.00% | 1.11% | 20.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0706567686 | T -> DEL | N | N | silent_mutation | Average:13.799; most accessible tissue: Callus, score: 27.088 | N | N | N | N |
| vg0706567686 | T -> C | LOC_Os07g11860.1 | upstream_gene_variant ; 360.0bp to feature; MODIFIER | silent_mutation | Average:13.799; most accessible tissue: Callus, score: 27.088 | N | N | N | N |
| vg0706567686 | T -> C | LOC_Os07g11860-LOC_Os07g11870 | intergenic_region ; MODIFIER | silent_mutation | Average:13.799; most accessible tissue: Callus, score: 27.088 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0706567686 | NA | 8.64E-27 | mr1309 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0706567686 | NA | 2.27E-08 | mr1488 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0706567686 | NA | 2.05E-18 | mr1566 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0706567686 | NA | 2.15E-08 | mr1776 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0706567686 | NA | 1.58E-06 | mr1886 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0706567686 | NA | 1.29E-35 | mr1181_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0706567686 | NA | 4.27E-29 | mr1238_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0706567686 | NA | 4.76E-07 | mr1408_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0706567686 | NA | 2.06E-25 | mr1484_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0706567686 | NA | 9.01E-22 | mr1551_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0706567686 | NA | 6.93E-23 | mr1609_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0706567686 | NA | 1.49E-07 | mr1783_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0706567686 | NA | 3.84E-33 | mr1841_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0706567686 | NA | 1.02E-20 | mr1900_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0706567686 | NA | 3.16E-19 | mr1945_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0706567686 | NA | 1.30E-09 | mr1947_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0706567686 | 1.32E-06 | NA | mr1986_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |