Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0706567685:

Variant ID: vg0706567685 (JBrowse)	Variation Type: INDEL
Chromosome: chr07	Position: 6567685
Reference Allele: ATT	Alternative Allele: A,GTT
Primary Allele: ATT	Secondary Allele: GTT

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

CAGCTGAGAGTAAATCTTGTTTAGTGAAGAAAATAGTTAAGATTAAGATGAAAATCGTACCGAGTTTTGTAAACATAGTGTTTTTATTTTTGAAAGTATT[ATT/A,GTT]
AAATGGGAATTTCTCCCTTGGCCAACTTAGAAAAGGGGTGGGGCGCCTTTTTGGTCTTTTCCTACAGTCGTATGGCTCTGATACCAGCTTTGTGGACCCC

Reverse complement sequence

GGGGTCCACAAAGCTGGTATCAGAGCCATACGACTGTAGGAAAAGACCAAAAAGGCGCCCCACCCCTTTTCTAAGTTGGCCAAGGGAGAAATTCCCATTT[AAT/T,AAC]
AATACTTTCAAAAATAAAAACACTATGTTTACAAAACTCGGTACGATTTTCATCTTAATCTTAACTATTTTCTTCACTAAACAAGATTTACTCTCAGCTG

Allele Frequencies:

Populations	Population Size	Frequency of ATT(primary allele)	Frequency of GTT(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	76.90%	1.20%	1.08%	20.74%	A: 0.08%
All Indica	2759	65.40%	1.80%	1.70%	30.99%	A: 0.14%
All Japonica	1512	98.70%	0.00%	0.20%	1.12%	NA
Aus	269	63.60%	2.60%	0.37%	33.46%	NA
Indica I	595	70.60%	1.50%	2.02%	25.88%	NA
Indica II	465	66.20%	1.70%	1.29%	30.54%	A: 0.22%
Indica III	913	62.80%	0.20%	1.97%	34.94%	A: 0.11%
Indica Intermediate	786	64.00%	3.80%	1.40%	30.53%	A: 0.25%
Temperate Japonica	767	98.20%	0.00%	0.26%	1.56%	NA
Tropical Japonica	504	99.40%	0.00%	0.00%	0.60%	NA
Japonica Intermediate	241	98.80%	0.00%	0.41%	0.83%	NA
VI/Aromatic	96	97.90%	1.00%	0.00%	1.04%	NA
Intermediate	90	81.10%	0.00%	0.00%	18.89%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0706567685	ATT -> DEL	N	N	silent_mutation	Average:13.799; most accessible tissue: Callus, score: 27.088	N	N	N	N
vg0706567685	ATT -> GTT	LOC_Os07g11860.1	upstream_gene_variant ; 359.0bp to feature; MODIFIER	silent_mutation	Average:13.799; most accessible tissue: Callus, score: 27.088	N	N	N	N
vg0706567685	ATT -> GTT	LOC_Os07g11860-LOC_Os07g11870	intergenic_region ; MODIFIER	silent_mutation	Average:13.799; most accessible tissue: Callus, score: 27.088	N	N	N	N
vg0706567685	ATT -> A	LOC_Os07g11860.1	upstream_gene_variant ; 360.0bp to feature; MODIFIER	silent_mutation	Average:13.799; most accessible tissue: Callus, score: 27.088	N	N	N	N
vg0706567685	ATT -> A	LOC_Os07g11860-LOC_Os07g11870	intergenic_region ; MODIFIER	silent_mutation	Average:13.799; most accessible tissue: Callus, score: 27.088	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0706567685	NA	4.57E-06	mr1103	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706567685	NA	2.68E-17	mr1566	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706567685	5.86E-07	5.09E-07	mr1970	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706567685	7.48E-08	1.64E-08	mr1973	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706567685	NA	2.30E-31	mr1085_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706567685	5.55E-07	NA	mr1301_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706567685	2.51E-06	NA	mr1410_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706567685	NA	2.21E-21	mr1551_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706567685	NA	8.50E-07	mr1620_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706567685	NA	2.72E-07	mr1804_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706567685	NA	8.12E-32	mr1841_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706567685	NA	1.76E-18	mr1945_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706567685	NA	6.06E-09	mr1947_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706567685	NA	3.81E-06	mr1970_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706567685	NA	9.30E-07	mr1973_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251