\
| Variant ID: vg0706566801 (JBrowse) | Variation Type: SNP |
| Chromosome: chr07 | Position: 6566801 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
GGGTCCACCAAGTAAGGAGCTGACTCAATAGCCAGCATACCAACCTCTCCCAAAAGAGCGTGGAATGCTGGTGGGTACGGCGAGGTGAGGAAAAAGTAGC[G/A]
GTCATGCCCTACTGCTGTGGAAGTAGAAGCCCCTGTGGTGCTGACCGTGGCTGCTCAAAGCTGCTCCTCCAGCTGGCTGACGTGCTCCTGACTCTCTCTC
GAGAGAGAGTCAGGAGCACGTCAGCCAGCTGGAGGAGCAGCTTTGAGCAGCCACGGTCAGCACCACAGGGGCTTCTACTTCCACAGCAGTAGGGCATGAC[C/T]
GCTACTTTTTCCTCACCTCGCCGTACCCACCAGCATTCCACGCTCTTTTGGGAGAGGTTGGTATGCTGGCTATTGAGTCAGCTCCTTACTTGGTGGACCC
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 84.70% | 0.20% | 4.06% | 11.05% | NA |
| All Indica | 2759 | 75.90% | 0.00% | 6.02% | 18.01% | NA |
| All Japonica | 1512 | 98.60% | 0.50% | 0.66% | 0.20% | NA |
| Aus | 269 | 90.00% | 0.00% | 4.46% | 5.58% | NA |
| Indica I | 595 | 71.80% | 0.00% | 4.71% | 23.53% | NA |
| Indica II | 465 | 84.70% | 0.00% | 5.38% | 9.89% | NA |
| Indica III | 913 | 72.30% | 0.10% | 8.21% | 19.39% | NA |
| Indica Intermediate | 786 | 78.10% | 0.00% | 4.83% | 17.05% | NA |
| Temperate Japonica | 767 | 97.70% | 0.90% | 1.30% | 0.13% | NA |
| Tropical Japonica | 504 | 99.80% | 0.00% | 0.00% | 0.20% | NA |
| Japonica Intermediate | 241 | 99.20% | 0.40% | 0.00% | 0.41% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 87.80% | 0.00% | 4.44% | 7.78% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0706566801 | G -> DEL | N | N | silent_mutation | Average:10.948; most accessible tissue: Callus, score: 33.951 | N | N | N | N |
| vg0706566801 | G -> A | LOC_Os07g11860.1 | intron_variant ; MODIFIER | silent_mutation | Average:10.948; most accessible tissue: Callus, score: 33.951 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0706566801 | 4.42E-06 | 3.69E-13 | Awn_length | Jap_All | Not | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
| vg0706566801 | 2.23E-07 | 1.75E-08 | mr1300 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0706566801 | 8.12E-06 | 1.10E-06 | mr1310 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0706566801 | NA | 9.06E-07 | mr1913 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0706566801 | 4.00E-06 | NA | mr1926 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0706566801 | 4.85E-06 | 2.25E-06 | mr1959 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0706566801 | NA | 8.23E-06 | mr1995 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |