\
| Variant ID: vg0706565900 (JBrowse) | Variation Type: SNP |
| Chromosome: chr07 | Position: 6565900 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele: Not determined.
TAGCGAACGTGGGTGGCTTGGTCCTCATAAACTCTCCAAAGCTCGATCCTCCGCGGTTGCTTTGGTTGTTTGCAATGGCTTGCAGAAGTTGGGTTTGAGT[A/G]
GCCATAACTCCGGCCAGGGTGGTTAGGTCAGGTGTCTGAGTTTCTTCATTGATGGTTGACGCCCGACGTCGGCTGGCCATCTGTGTAGGCCGATAAAGTA
TACTTTATCGGCCTACACAGATGGCCAGCCGACGTCGGGCGTCAACCATCAATGAAGAAACTCAGACACCTGACCTAACCACCCTGGCCGGAGTTATGGC[T/C]
ACTCAAACCCAACTTCTGCAAGCCATTGCAAACAACCAAAGCAACCGCGGAGGATCGAGCTTTGGAGAGTTTATGAGGACCAAGCCACCCACGTTCGCTA
| Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 74.70% | 2.50% | 22.43% | 0.36% | NA |
| All Indica | 2759 | 63.20% | 3.30% | 32.91% | 0.58% | NA |
| All Japonica | 1512 | 99.10% | 0.10% | 0.79% | 0.00% | NA |
| Aus | 269 | 42.80% | 8.20% | 48.70% | 0.37% | NA |
| Indica I | 595 | 92.10% | 2.70% | 5.21% | 0.00% | NA |
| Indica II | 465 | 81.30% | 2.20% | 16.56% | 0.00% | NA |
| Indica III | 913 | 28.90% | 4.40% | 65.17% | 1.53% | NA |
| Indica Intermediate | 786 | 70.40% | 3.30% | 26.08% | 0.25% | NA |
| Temperate Japonica | 767 | 98.60% | 0.30% | 1.17% | 0.00% | NA |
| Tropical Japonica | 504 | 99.80% | 0.00% | 0.20% | 0.00% | NA |
| Japonica Intermediate | 241 | 99.20% | 0.00% | 0.83% | 0.00% | NA |
| VI/Aromatic | 96 | 97.90% | 1.00% | 1.04% | 0.00% | NA |
| Intermediate | 90 | 90.00% | 1.10% | 8.89% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0706565900 | A -> DEL | LOC_Os07g11860.1 | N | frameshift_variant | Average:13.159; most accessible tissue: Zhenshan97 young leaf, score: 24.604 | N | N | N | N |
| vg0706565900 | A -> G | LOC_Os07g11860.1 | synonymous_variant ; p.Ala211Ala; LOW | synonymous_codon | Average:13.159; most accessible tissue: Zhenshan97 young leaf, score: 24.604 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0706565900 | NA | 8.91E-29 | mr1075 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0706565900 | NA | 2.05E-06 | mr1085 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0706565900 | NA | 1.53E-08 | mr1103 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0706565900 | 1.63E-06 | 8.02E-09 | mr1104 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0706565900 | NA | 3.69E-08 | mr1107 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0706565900 | NA | 1.59E-09 | mr1226 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0706565900 | NA | 1.24E-06 | mr1437 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0706565900 | NA | 3.97E-28 | mr1546 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0706565900 | NA | 1.34E-07 | mr1560 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0706565900 | NA | 9.33E-19 | mr1566 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0706565900 | NA | 1.71E-31 | mr1085_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0706565900 | NA | 4.04E-36 | mr1107_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0706565900 | NA | 1.62E-24 | mr1233_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0706565900 | NA | 9.76E-17 | mr1342_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0706565900 | NA | 2.95E-17 | mr1592_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0706565900 | NA | 3.23E-22 | mr1609_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0706565900 | NA | 3.32E-19 | mr1637_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0706565900 | NA | 3.90E-07 | mr1749_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0706565900 | NA | 2.21E-19 | mr1900_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0706565900 | NA | 1.80E-18 | mr1945_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0706565900 | NA | 7.61E-09 | mr1947_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |