\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0706562208:

Variant ID: vg0706562208 (JBrowse)Variation Type: SNP
Chromosome: chr07Position: 6562208
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GCTTCTTTGATAATGTCAGGTCCAAATACCGCCCGTTCACCTGTCTTGGTCCACATTAGTGGGGTATGACATCATCGACCAAATAATGCCTCATTTGGTG[G/A]
CATCTTTAGGCTCGCTTGGAAACTGTTGTTGTAGGAGAATTCGGCGTAGGGCAAACATCTCTCCCAGTCTTTGCTAAAATCCAATGCACAAGCTCTCAAC

Reverse complement sequence

GTTGAGAGCTTGTGCATTGGATTTTAGCAAAGACTGGGAGAGATGTTTGCCCTACGCCGAATTCTCCTACAACAACAGTTTCCAAGCGAGCCTAAAGATG[C/T]
CACCAAATGAGGCATTATTTGGTCGATGATGTCATACCCCACTAATGTGGACCAAGACAGGTGAACGGGCGGTATTTGGACCTGACATTATCAAAGAAGC

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 53.30% 9.80% 27.40% 9.54% NA
All Indica  2759 29.00% 15.00% 43.02% 12.94% NA
All Japonica  1512 98.10% 0.20% 1.19% 0.53% NA
Aus  269 29.40% 15.20% 28.62% 26.77% NA
Indica I  595 53.80% 8.90% 18.32% 18.99% NA
Indica II  465 33.30% 12.00% 44.73% 9.89% NA
Indica III  913 7.00% 20.50% 62.65% 9.86% NA
Indica Intermediate  786 33.20% 15.10% 37.91% 13.74% NA
Temperate Japonica  767 97.30% 0.30% 1.69% 0.78% NA
Tropical Japonica  504 99.40% 0.00% 0.40% 0.20% NA
Japonica Intermediate  241 97.90% 0.40% 1.24% 0.41% NA
VI/Aromatic  96 97.90% 0.00% 1.04% 1.04% NA
Intermediate  90 70.00% 2.20% 13.33% 14.44% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0706562208 G -> DEL N N silent_mutation Average:12.243; most accessible tissue: Callus, score: 31.631 N N N N
vg0706562208 G -> A LOC_Os07g11860.1 intron_variant ; MODIFIER silent_mutation Average:12.243; most accessible tissue: Callus, score: 31.631 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0706562208 NA 3.87E-19 mr1518 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706562208 NA 2.42E-06 mr1761 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706562208 NA 7.54E-37 mr1082_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706562208 8.18E-06 NA mr1137_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706562208 NA 2.24E-41 mr1145_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706562208 NA 6.41E-28 mr1238_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706562208 NA 5.80E-17 mr1342_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706562208 NA 3.68E-08 mr1408_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706562208 NA 1.87E-16 mr1592_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706562208 NA 2.65E-22 mr1609_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706562208 NA 1.37E-18 mr1637_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706562208 NA 3.97E-07 mr1754_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706562208 NA 7.83E-08 mr1783_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706562208 NA 4.30E-32 mr1841_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706562208 NA 5.75E-25 mr1916_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706562208 NA 1.22E-19 mr1945_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251