\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0706300847:

Variant ID: vg0706300847 (JBrowse)Variation Type: SNP
Chromosome: chr07Position: 6300847
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


ATCGGGAGAGCAGCTCTCCGAAACCTGCGCCTTCTACGTTTTGCACTAGAAGAAGGTAGCAATAAGATTTTTGGGTTTTTGGGAAGCGCTCCACGCGACT[G/A]
CTCCCTATTCGTTCATACGGCTCGTCTTCCTCTTCGCTCGCGTGCTGTGCGCTACCGTTAAGGGACGGTACCGTGAATTCTTCCTGCCGAGCAACCGGAT

Reverse complement sequence

ATCCGGTTGCTCGGCAGGAAGAATTCACGGTACCGTCCCTTAACGGTAGCGCACAGCACGCGAGCGAAGAGGAAGACGAGCCGTATGAACGAATAGGGAG[C/T]
AGTCGCGTGGAGCGCTTCCCAAAAACCCAAAAATCTTATTGCTACCTTCTTCTAGTGCAAAACGTAGAAGGCGCAGGTTTCGGAGAGCTGCTCTCCCGAT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 77.70% 8.00% 2.73% 11.53% NA
All Indica  2759 93.10% 0.70% 2.83% 3.33% NA
All Japonica  1512 56.30% 22.80% 2.78% 18.12% NA
Aus  269 34.60% 0.00% 2.23% 63.20% NA
Indica I  595 90.80% 1.00% 6.22% 2.02% NA
Indica II  465 95.30% 1.50% 3.23% 0.00% NA
Indica III  913 96.70% 0.00% 0.00% 3.29% NA
Indica Intermediate  786 89.40% 0.90% 3.31% 6.36% NA
Temperate Japonica  767 69.50% 1.30% 3.52% 25.68% NA
Tropical Japonica  504 22.80% 63.10% 2.38% 11.71% NA
Japonica Intermediate  241 84.60% 6.60% 1.24% 7.47% NA
VI/Aromatic  96 93.80% 4.20% 0.00% 2.08% NA
Intermediate  90 76.70% 12.20% 3.33% 7.78% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0706300847 G -> DEL LOC_Os07g11450.1 N frameshift_variant Average:51.613; most accessible tissue: Zhenshan97 young leaf, score: 76.773 N N N N
vg0706300847 G -> A LOC_Os07g11450.1 synonymous_variant ; p.Ser88Ser; LOW synonymous_codon Average:51.613; most accessible tissue: Zhenshan97 young leaf, score: 76.773 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0706300847 NA 1.70E-06 mr1125 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706300847 NA 2.70E-22 mr1301 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706300847 NA 2.04E-16 mr1410 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706300847 NA 7.73E-07 mr1642 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706300847 NA 6.59E-06 mr1642 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706300847 3.17E-06 1.32E-09 mr1742 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706300847 NA 4.25E-09 mr1742 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706300847 NA 1.17E-11 mr1871 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706300847 3.83E-08 NA mr1082_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706300847 1.51E-09 NA mr1083_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706300847 3.40E-06 NA mr1085_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706300847 NA 3.85E-08 mr1125_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706300847 2.04E-06 NA mr1145_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706300847 NA 3.16E-06 mr1217_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706300847 NA 4.72E-27 mr1301_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706300847 NA 4.94E-11 mr1304_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706300847 NA 1.15E-15 mr1334_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706300847 NA 5.75E-11 mr1408_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706300847 NA 1.04E-18 mr1410_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706300847 NA 2.13E-06 mr1422_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706300847 NA 1.01E-14 mr1552_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706300847 NA 1.20E-07 mr1554_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706300847 NA 1.88E-08 mr1696_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706300847 NA 2.45E-10 mr1705_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706300847 NA 1.68E-06 mr1707_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706300847 NA 1.97E-06 mr1798_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706300847 NA 3.39E-09 mr1819_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706300847 NA 1.73E-06 mr1860_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706300847 NA 4.48E-10 mr1905_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706300847 NA 3.18E-14 mr1993_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251