\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0706285104:

Variant ID: vg0706285104 (JBrowse)Variation Type: SNP
Chromosome: chr07Position: 6285104
Reference Allele: TAlternative Allele: G
Primary Allele: TSecondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.72, T: 0.28, others allele: 0.00, population size: 54. )

Flanking Sequence (100 bp) in Reference Genome:


GTAATCGTCGATTCCTTGCTGCAAACCACCCGGTACGGAAGAAAGGCAATCACTTTGAACATAAGGCGGACCACCGTGCGAAGCCTAAACATCGCAGCAG[T/G]
AAAACAATGTTTGCTATGGTTAAAGAACTTAAAGTAGTGTTCGGAAAGGGGCATAGAAGCCAGCCTATAGAGAGCGAAGATGGTCACGCGGCGATGTGAA

Reverse complement sequence

TTCACATCGCCGCGTGACCATCTTCGCTCTCTATAGGCTGGCTTCTATGCCCCTTTCCGAACACTACTTTAAGTTCTTTAACCATAGCAAACATTGTTTT[A/C]
CTGCTGCGATGTTTAGGCTTCGCACGGTGGTCCGCCTTATGTTCAAAGTGATTGCCTTTCTTCCGTACCGGGTGGTTTGCAGCAAGGAATCGACGATTAC

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 75.80% 10.50% 1.63% 12.06% NA
All Indica  2759 79.20% 16.50% 0.65% 3.70% NA
All Japonica  1512 78.40% 0.10% 2.84% 18.58% NA
Aus  269 14.90% 13.80% 4.83% 66.54% NA
Indica I  595 77.60% 19.00% 0.67% 2.69% NA
Indica II  465 99.40% 0.60% 0.00% 0.00% NA
Indica III  913 72.70% 23.20% 0.44% 3.61% NA
Indica Intermediate  786 76.00% 16.00% 1.27% 6.74% NA
Temperate Japonica  767 68.20% 0.30% 4.95% 26.60% NA
Tropical Japonica  504 88.10% 0.00% 0.40% 11.51% NA
Japonica Intermediate  241 90.90% 0.00% 1.24% 7.88% NA
VI/Aromatic  96 97.90% 0.00% 0.00% 2.08% NA
Intermediate  90 85.60% 4.40% 3.33% 6.67% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0706285104 T -> DEL LOC_Os07g11420.1 N frameshift_variant Average:44.123; most accessible tissue: Minghui63 flag leaf, score: 66.004 N N N N
vg0706285104 T -> G LOC_Os07g11420.1 missense_variant ; p.Ser219Arg; MODERATE nonsynonymous_codon ; S219R Average:44.123; most accessible tissue: Minghui63 flag leaf, score: 66.004 benign 0.773 DELETERIOUS 0.03

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0706285104 NA 3.01E-07 mr1063 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706285104 NA 5.90E-07 mr1177 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706285104 NA 3.54E-06 mr1215 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706285104 NA 2.66E-07 mr1220 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706285104 NA 4.35E-07 mr1352 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706285104 NA 2.91E-07 mr1422 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706285104 3.73E-06 3.73E-06 mr1681 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706285104 NA 5.20E-10 mr1739 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706285104 NA 7.49E-08 mr1739 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706285104 NA 2.10E-07 mr1740 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706285104 NA 9.39E-07 mr1800 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706285104 NA 1.30E-06 mr1800 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706285104 NA 1.18E-07 mr1806 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706285104 NA 1.96E-06 mr1220_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706285104 NA 3.06E-11 mr1739_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706285104 NA 1.62E-07 mr1870_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251