Search for Variation information by Variation ID:
Detailed information for vg0706269309:
| Variant ID: vg0706269309 (JBrowse) | Variation Type: SNP |
| Chromosome: chr07 | Position: 6269309 |
| Reference Allele: T | Alternative Allele: C,A |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
Flanking Sequence (100 bp) in Reference Genome:
ATTATGTTCTTCCAAACAAACTTTTGTAGTGCTGCAGAAGTTATTCTTGCCACTGCTTCTGCCTCAATCCATCTTGAAAAGTATTCAATTGCAACAATGA[T/C,A]
AAAGCGCAAATCTCCCTTCGCTCTTGGAAGAGGACCTACTATATCTATTCCCCATCTGTAAAAAGGCCAGACTGGCGGAATTGGTTGCAGTTCTTTGGGT
Reverse complement sequence
ACCCAAAGAACTGCAACCAATTCCGCCAGTCTGGCCTTTTTACAGATGGGGAATAGATATAGTAGGTCCTCTTCCAAGAGCGAAGGGAGATTTGCGCTTT[A/G,T]
TCATTGTTGCAATTGAATACTTTTCAAGATGGATTGAGGCAGAAGCAGTGGCAAGAATAACTTCTGCAGCACTACAAAAGTTTGTTTGGAAGAACATAAT
Allele Frequencies:
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 59.90% | 12.40% | 17.90% | 9.65% | A: 0.11% |
| All Indica | 2759 | 74.60% | 2.20% | 17.14% | 5.87% | A: 0.18% |
| All Japonica | 1512 | 39.90% | 33.50% | 11.31% | 15.34% | NA |
| Aus | 269 | 8.90% | 0.40% | 69.52% | 21.19% | NA |
| Indica I | 595 | 69.10% | 3.20% | 15.80% | 11.93% | NA |
| Indica II | 465 | 89.00% | 3.70% | 6.45% | 0.00% | A: 0.86% |
| Indica III | 913 | 72.80% | 0.90% | 21.03% | 5.26% | NA |
| Indica Intermediate | 786 | 72.30% | 2.20% | 19.97% | 5.47% | A: 0.13% |
| Temperate Japonica | 767 | 19.80% | 47.70% | 11.34% | 21.12% | NA |
| Tropical Japonica | 504 | 66.70% | 8.10% | 13.89% | 11.31% | NA |
| Japonica Intermediate | 241 | 47.70% | 41.10% | 5.81% | 5.39% | NA |
| VI/Aromatic | 96 | 94.80% | 2.10% | 2.08% | 1.04% | NA |
| Intermediate | 90 | 63.30% | 17.80% | 14.44% | 4.44% | NA |
Allele Effect:
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0706269309 | T -> DEL | LOC_Os07g11400.1 | N | frameshift_variant | Average:17.471; most accessible tissue: Zhenshan97 panicle, score: 24.575 | N | N | N | N |
| vg0706269309 | T -> A | LOC_Os07g11400.1 | missense_variant ; p.Ile1490Phe; MODERATE | nonsynonymous_codon ; I1490F | Average:17.471; most accessible tissue: Zhenshan97 panicle, score: 24.575 | benign  |
1.181 |
DELETERIOUS | 0.04 |
| vg0706269309 | T -> C | LOC_Os07g11400.1 | missense_variant ; p.Ile1490Val; MODERATE | nonsynonymous_codon ; I1490V | Average:17.471; most accessible tissue: Zhenshan97 panicle, score: 24.575 | benign |
-0.482 |
TOLERATED | 0.60 |
Putative Genotype-Phenotype Associations:
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0706269309 | NA | 5.00E-13 | mr1035 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0706269309 | NA | 5.38E-06 | mr1097 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0706269309 | NA | 1.57E-06 | mr1149 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0706269309 | NA | 7.31E-09 | mr1252 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0706269309 | NA | 1.42E-12 | mr1626 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0706269309 | 5.47E-06 | NA | mr1773 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0706269309 | 5.06E-06 | 5.06E-06 | mr1773 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0706269309 | 9.00E-06 | NA | mr1802 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0706269309 | 1.84E-06 | 1.84E-06 | mr1802 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0706269309 | NA | 7.17E-06 | mr1837 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |