| Variant ID: vg0706245344 (JBrowse) | Variation Type: SNP |
| Chromosome: chr07 | Position: 6245344 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: T | Secondary Allele: C |
Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.54, C: 0.47, others allele: 0.00, population size: 94. )
TTCTCTGTATATACGTGCCTGATCAAGCATATATTGGAGTTTTCTGAAAAACAAAATTCATATATAAGATAGCTTTGATGTGCACGTTCAGTCTTTCACC[T/C]
ACTTTTTTTTTTTGTTGTACTGCAATCTTGAGAGGCCTAGGCAGTTGGATAACAGAGATATATTAACAAGGCACGGAATTATATTTATATGGACATAAGA
TCTTATGTCCATATAAATATAATTCCGTGCCTTGTTAATATATCTCTGTTATCCAACTGCCTAGGCCTCTCAAGATTGCAGTACAACAAAAAAAAAAAGT[A/G]
GGTGAAAGACTGAACGTGCACATCAAAGCTATCTTATATATGAATTTTGTTTTTCAGAAAACTCCAATATATGCTTGATCAGGCACGTATATACAGAGAA
| Populations | Population Size | Frequency of T(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 77.80% | 22.10% | 0.15% | 0.00% | NA |
| All Indica | 2759 | 78.30% | 21.70% | 0.04% | 0.00% | NA |
| All Japonica | 1512 | 86.70% | 13.10% | 0.20% | 0.00% | NA |
| Aus | 269 | 12.30% | 86.60% | 1.12% | 0.00% | NA |
| Indica I | 595 | 76.50% | 23.50% | 0.00% | 0.00% | NA |
| Indica II | 465 | 99.10% | 0.90% | 0.00% | 0.00% | NA |
| Indica III | 913 | 72.10% | 27.90% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 74.60% | 25.30% | 0.13% | 0.00% | NA |
| Temperate Japonica | 767 | 73.80% | 25.80% | 0.39% | 0.00% | NA |
| Tropical Japonica | 504 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 97.90% | 2.10% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 86.70% | 13.30% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0706245344 | T -> C | LOC_Os07g11320.1 | upstream_gene_variant ; 3345.0bp to feature; MODIFIER | silent_mutation | Average:55.55; most accessible tissue: Zhenshan97 flag leaf, score: 78.0 | N | N | N | N |
| vg0706245344 | T -> C | LOC_Os07g11330.1 | upstream_gene_variant ; 464.0bp to feature; MODIFIER | silent_mutation | Average:55.55; most accessible tissue: Zhenshan97 flag leaf, score: 78.0 | N | N | N | N |
| vg0706245344 | T -> C | LOC_Os07g11340.1 | downstream_gene_variant ; 623.0bp to feature; MODIFIER | silent_mutation | Average:55.55; most accessible tissue: Zhenshan97 flag leaf, score: 78.0 | N | N | N | N |
| vg0706245344 | T -> C | LOC_Os07g11350.1 | downstream_gene_variant ; 3752.0bp to feature; MODIFIER | silent_mutation | Average:55.55; most accessible tissue: Zhenshan97 flag leaf, score: 78.0 | N | N | N | N |
| vg0706245344 | T -> C | LOC_Os07g11330-LOC_Os07g11340 | intergenic_region ; MODIFIER | silent_mutation | Average:55.55; most accessible tissue: Zhenshan97 flag leaf, score: 78.0 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0706245344 | NA | 1.48E-10 | mr1063 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0706245344 | NA | 8.78E-06 | mr1088 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0706245344 | NA | 5.92E-06 | mr1177 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0706245344 | NA | 6.06E-09 | mr1213 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0706245344 | NA | 8.10E-08 | mr1220 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0706245344 | NA | 3.06E-06 | mr1246 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0706245344 | NA | 4.33E-08 | mr1352 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0706245344 | NA | 1.30E-08 | mr1422 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0706245344 | NA | 5.33E-06 | mr1740 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0706245344 | NA | 2.50E-08 | mr1806 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
Address: Room B111, National Key Laboratory of Crop Genetic Improvement, Huazhong Agricultural university, Wuhan, 430070, China
Comments or Questions? Please contact us. Our website: http://xielab.ncpgr.cn/