\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0706245344:

Variant ID: vg0706245344 (JBrowse)Variation Type: SNP
Chromosome: chr07Position: 6245344
Reference Allele: TAlternative Allele: C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.54, C: 0.47, others allele: 0.00, population size: 94. )

Flanking Sequence (100 bp) in Reference Genome:


TTCTCTGTATATACGTGCCTGATCAAGCATATATTGGAGTTTTCTGAAAAACAAAATTCATATATAAGATAGCTTTGATGTGCACGTTCAGTCTTTCACC[T/C]
ACTTTTTTTTTTTGTTGTACTGCAATCTTGAGAGGCCTAGGCAGTTGGATAACAGAGATATATTAACAAGGCACGGAATTATATTTATATGGACATAAGA

Reverse complement sequence

TCTTATGTCCATATAAATATAATTCCGTGCCTTGTTAATATATCTCTGTTATCCAACTGCCTAGGCCTCTCAAGATTGCAGTACAACAAAAAAAAAAAGT[A/G]
GGTGAAAGACTGAACGTGCACATCAAAGCTATCTTATATATGAATTTTGTTTTTCAGAAAACTCCAATATATGCTTGATCAGGCACGTATATACAGAGAA

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 77.80% 22.10% 0.15% 0.00% NA
All Indica  2759 78.30% 21.70% 0.04% 0.00% NA
All Japonica  1512 86.70% 13.10% 0.20% 0.00% NA
Aus  269 12.30% 86.60% 1.12% 0.00% NA
Indica I  595 76.50% 23.50% 0.00% 0.00% NA
Indica II  465 99.10% 0.90% 0.00% 0.00% NA
Indica III  913 72.10% 27.90% 0.00% 0.00% NA
Indica Intermediate  786 74.60% 25.30% 0.13% 0.00% NA
Temperate Japonica  767 73.80% 25.80% 0.39% 0.00% NA
Tropical Japonica  504 100.00% 0.00% 0.00% 0.00% NA
Japonica Intermediate  241 100.00% 0.00% 0.00% 0.00% NA
VI/Aromatic  96 97.90% 2.10% 0.00% 0.00% NA
Intermediate  90 86.70% 13.30% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0706245344 T -> C LOC_Os07g11320.1 upstream_gene_variant ; 3345.0bp to feature; MODIFIER silent_mutation Average:55.55; most accessible tissue: Zhenshan97 flag leaf, score: 78.0 N N N N
vg0706245344 T -> C LOC_Os07g11330.1 upstream_gene_variant ; 464.0bp to feature; MODIFIER silent_mutation Average:55.55; most accessible tissue: Zhenshan97 flag leaf, score: 78.0 N N N N
vg0706245344 T -> C LOC_Os07g11340.1 downstream_gene_variant ; 623.0bp to feature; MODIFIER silent_mutation Average:55.55; most accessible tissue: Zhenshan97 flag leaf, score: 78.0 N N N N
vg0706245344 T -> C LOC_Os07g11350.1 downstream_gene_variant ; 3752.0bp to feature; MODIFIER silent_mutation Average:55.55; most accessible tissue: Zhenshan97 flag leaf, score: 78.0 N N N N
vg0706245344 T -> C LOC_Os07g11330-LOC_Os07g11340 intergenic_region ; MODIFIER silent_mutation Average:55.55; most accessible tissue: Zhenshan97 flag leaf, score: 78.0 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0706245344 NA 1.48E-10 mr1063 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706245344 NA 8.78E-06 mr1088 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706245344 NA 5.92E-06 mr1177 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706245344 NA 6.06E-09 mr1213 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706245344 NA 8.10E-08 mr1220 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706245344 NA 3.06E-06 mr1246 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706245344 NA 4.33E-08 mr1352 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706245344 NA 1.30E-08 mr1422 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706245344 NA 5.33E-06 mr1740 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706245344 NA 2.50E-08 mr1806 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706245344 NA 5.75E-07 mr1870 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706245344 NA 2.89E-08 mr1063_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706245344 NA 1.04E-07 mr1220_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706245344 NA 1.53E-09 mr1221_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706245344 NA 4.38E-06 mr1422_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706245344 NA 4.56E-07 mr1582_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706245344 NA 2.59E-09 mr1707_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706245344 NA 1.08E-06 mr1721_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706245344 NA 1.69E-09 mr1739_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706245344 NA 2.81E-06 mr1740_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706245344 NA 5.82E-07 mr1743_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706245344 NA 1.45E-08 mr1829_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706245344 NA 5.35E-11 mr1870_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251