\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0706198216:

Variant ID: vg0706198216 (JBrowse)Variation Type: SNP
Chromosome: chr07Position: 6198216
Reference Allele: AAlternative Allele: T
Primary Allele: ASecondary Allele: T

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.69, A: 0.32, others allele: 0.00, population size: 38. )

Flanking Sequence (100 bp) in Reference Genome:


TCACCCCCCCCCCCTCTAGTCGGCCTCCTTGATCCTACAGCCACCCCTTTTAGTTTTGCCGAAATATTGTTTCAACAAGAACTACGAGGAAGCCGAGATA[A/T]
TGTTTCGACAAGAACTACGAGGAAGTTAAGTTTCCAACAGGTCCACATCTGATAATAAAGAGACTCTCAAGGTTTGCTACCTCAACTTCTTATCTCTTGA

Reverse complement sequence

TCAAGAGATAAGAAGTTGAGGTAGCAAACCTTGAGAGTCTCTTTATTATCAGATGTGGACCTGTTGGAAACTTAACTTCCTCGTAGTTCTTGTCGAAACA[T/A]
TATCTCGGCTTCCTCGTAGTTCTTGTTGAAACAATATTTCGGCAAAACTAAAAGGGGTGGCTGTAGGATCAAGGAGGCCGACTAGAGGGGGGGGGGGTGA

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 84.80% 14.70% 0.36% 0.13% NA
All Indica  2759 82.80% 17.00% 0.04% 0.11% NA
All Japonica  1512 87.90% 11.70% 0.40% 0.00% NA
Aus  269 82.20% 13.00% 3.72% 1.12% NA
Indica I  595 79.70% 20.20% 0.00% 0.17% NA
Indica II  465 99.40% 0.60% 0.00% 0.00% NA
Indica III  913 76.10% 23.80% 0.00% 0.11% NA
Indica Intermediate  786 83.20% 16.50% 0.13% 0.13% NA
Temperate Japonica  767 91.40% 8.20% 0.39% 0.00% NA
Tropical Japonica  504 82.30% 17.10% 0.60% 0.00% NA
Japonica Intermediate  241 88.40% 11.60% 0.00% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 83.30% 16.70% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0706198216 A -> DEL N N silent_mutation Average:40.695; most accessible tissue: Callus, score: 62.154 N N N N
vg0706198216 A -> T LOC_Os07g11250.1 upstream_gene_variant ; 2878.0bp to feature; MODIFIER silent_mutation Average:40.695; most accessible tissue: Callus, score: 62.154 N N N N
vg0706198216 A -> T LOC_Os07g11240.1 downstream_gene_variant ; 3866.0bp to feature; MODIFIER silent_mutation Average:40.695; most accessible tissue: Callus, score: 62.154 N N N N
vg0706198216 A -> T LOC_Os07g11240-LOC_Os07g11250 intergenic_region ; MODIFIER silent_mutation Average:40.695; most accessible tissue: Callus, score: 62.154 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0706198216 NA 5.72E-07 mr1063 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706198216 NA 4.37E-09 mr1177 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706198216 NA 2.33E-06 mr1177 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706198216 NA 5.76E-06 mr1220 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706198216 NA 5.73E-07 mr1352 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706198216 NA 4.24E-08 mr1739 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706198216 NA 1.69E-07 mr1739 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706198216 NA 2.67E-07 mr1740 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706198216 NA 2.46E-06 mr1800 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706198216 NA 4.87E-08 mr1806 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706198216 NA 7.41E-06 mr1159_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706198216 NA 2.61E-06 mr1220_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706198216 NA 1.58E-06 mr1397_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706198216 NA 3.82E-06 mr1738_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706198216 NA 3.72E-08 mr1870_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251