\
| Variant ID: vg0706194043 (JBrowse) | Variation Type: SNP |
| Chromosome: chr07 | Position: 6194043 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
TCCTCGGCTGCTTGGGACATACCCTCCTCTTCCACTCTGCCGCCTCCTGCTCCTGAGCGCCCTGCCTCTGTGGCTCGTCGTGAGCCGTCTCCCTTATTCC[A/G]
CAATTTACGGAGTCTTTTTGGTCTTTGCTCCACGGAGGCCAAAAAGAACCGCCGATTGCGGAATTCGGCGAAGAAAACGGCTCGTGATGTCAAGTTCCTC
GAGGAACTTGACATCACGAGCCGTTTTCTTCGCCGAATTCCGCAATCGGCGGTTCTTTTTGGCCTCCGTGGAGCAAAGACCAAAAAGACTCCGTAAATTG[T/C]
GGAATAAGGGAGACGGCTCACGACGAGCCACAGAGGCAGGGCGCTCAGGAGCAGGAGGCGGCAGAGTGGAAGAGGAGGGTATGTCCCAAGCAGCCGAGGA
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 62.00% | 15.80% | 18.51% | 3.72% | NA |
| All Indica | 2759 | 67.90% | 6.40% | 20.80% | 4.89% | NA |
| All Japonica | 1512 | 57.80% | 36.20% | 6.02% | 0.00% | NA |
| Aus | 269 | 9.70% | 2.20% | 74.72% | 13.38% | NA |
| Indica I | 595 | 53.90% | 10.40% | 27.56% | 8.07% | NA |
| Indica II | 465 | 82.80% | 9.00% | 7.96% | 0.22% | NA |
| Indica III | 913 | 71.90% | 3.20% | 21.25% | 3.72% | NA |
| Indica Intermediate | 786 | 65.10% | 5.50% | 22.77% | 6.62% | NA |
| Temperate Japonica | 767 | 39.40% | 52.20% | 8.47% | 0.00% | NA |
| Tropical Japonica | 504 | 86.90% | 9.50% | 3.57% | 0.00% | NA |
| Japonica Intermediate | 241 | 55.60% | 41.10% | 3.32% | 0.00% | NA |
| VI/Aromatic | 96 | 95.80% | 2.10% | 2.08% | 0.00% | NA |
| Intermediate | 90 | 68.90% | 17.80% | 7.78% | 5.56% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0706194043 | A -> DEL | LOC_Os07g11240.1 | N | frameshift_variant | Average:53.942; most accessible tissue: Minghui63 flag leaf, score: 77.153 | N | N | N | N |
| vg0706194043 | A -> G | LOC_Os07g11240.1 | missense_variant ; p.His1640Arg; MODERATE | nonsynonymous_codon ; H1640R | Average:53.942; most accessible tissue: Minghui63 flag leaf, score: 77.153 | unknown | unknown | TOLERATED | 1.00 |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0706194043 | NA | 2.15E-14 | mr1035 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0706194043 | NA | 3.23E-07 | mr1097 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0706194043 | NA | 4.41E-06 | mr1149 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0706194043 | NA | 2.69E-08 | mr1252 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0706194043 | NA | 3.18E-06 | mr1387 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0706194043 | 3.44E-06 | 6.59E-14 | mr1626 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0706194043 | 5.49E-06 | NA | mr1773 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0706194043 | 4.33E-06 | 4.33E-06 | mr1773 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0706194043 | 2.41E-06 | 2.41E-06 | mr1994 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |