\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0706192930:

Variant ID: vg0706192930 (JBrowse)Variation Type: SNP
Chromosome: chr07Position: 6192930
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.93, A: 0.07, others allele: 0.00, population size: 30. )

Flanking Sequence (100 bp) in Reference Genome:


CCTGTCCCTCTTTCAATTGCTGCAATCCCAGGATTTTTCGGACTTTTCGAAAAATTTTCAGACATATCCGAAAAACATCAGAACCGTGCGCAACTCTTCT[G/A]
TATCCTTTCGGACATATCCGAAAATTTTCGGAAATATCCGAAAATCTCGGGGTCCTTATATATCACCCCGTGGACTCCCTTCTCTCTCCTTTCCACTTCT

Reverse complement sequence

AGAAGTGGAAAGGAGAGAGAAGGGAGTCCACGGGGTGATATATAAGGACCCCGAGATTTTCGGATATTTCCGAAAATTTTCGGATATGTCCGAAAGGATA[C/T]
AGAAGAGTTGCGCACGGTTCTGATGTTTTTCGGATATGTCTGAAAATTTTTCGAAAAGTCCGAAAAATCCTGGGATTGCAGCAATTGAAAGAGGGACAGG

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 81.90% 14.20% 1.12% 2.75% NA
All Indica  2759 80.20% 16.80% 1.01% 1.99% NA
All Japonica  1512 89.10% 10.60% 0.26% 0.00% NA
Aus  269 53.20% 13.00% 7.43% 26.39% NA
Indica I  595 77.60% 19.50% 1.01% 1.85% NA
Indica II  465 99.40% 0.60% 0.00% 0.00% NA
Indica III  913 73.50% 23.50% 0.77% 2.19% NA
Indica Intermediate  786 78.60% 16.40% 1.91% 3.05% NA
Temperate Japonica  767 93.60% 6.30% 0.13% 0.00% NA
Tropical Japonica  504 82.50% 16.90% 0.60% 0.00% NA
Japonica Intermediate  241 88.40% 11.60% 0.00% 0.00% NA
VI/Aromatic  96 99.00% 0.00% 0.00% 1.04% NA
Intermediate  90 81.10% 14.40% 1.11% 3.33% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0706192930 G -> DEL N N silent_mutation Average:40.316; most accessible tissue: Minghui63 panicle, score: 50.413 N N N N
vg0706192930 G -> A LOC_Os07g11240.1 intron_variant ; MODIFIER silent_mutation Average:40.316; most accessible tissue: Minghui63 panicle, score: 50.413 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0706192930 NA 5.72E-07 mr1063 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706192930 NA 1.11E-07 mr1177 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706192930 NA 2.33E-06 mr1177 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706192930 NA 5.76E-06 mr1220 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706192930 NA 5.73E-07 mr1352 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706192930 NA 8.16E-09 mr1739 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706192930 NA 1.69E-07 mr1739 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706192930 NA 2.67E-07 mr1740 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706192930 NA 8.29E-06 mr1798 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706192930 NA 4.87E-08 mr1806 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706192930 NA 6.26E-07 mr1159_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706192930 NA 2.61E-06 mr1220_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706192930 3.74E-06 3.98E-08 mr1397_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706192930 NA 5.27E-06 mr1428_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706192930 NA 5.63E-06 mr1669_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706192930 NA 9.55E-07 mr1738_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706192930 NA 7.89E-06 mr1759_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706192930 NA 3.72E-08 mr1870_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251