\
| Variant ID: vg0706189186 (JBrowse) | Variation Type: SNP |
| Chromosome: chr07 | Position: 6189186 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
GTACTTTGGGTGCCTAAGGCACTTGTTACTAACATGAGAGGACCCAAGCAAGTATGGGTACCTAAAATTAGAAATTGATCTCTTGTAGGAATATGTCTCC[G/A]
GTGGAAGAAGTTGGGTAATTGATAGTGGATGCACAAATCACATGACCAGAGAAGAATCAATGTTTTCAACTCTTGATCCAAATGGCACTTCACAAGATAA
TTATCTTGTGAAGTGCCATTTGGATCAAGAGTTGAAAACATTGATTCTTCTCTGGTCATGTGATTTGTGCATCCACTATCAATTACCCAACTTCTTCCAC[C/T]
GGAGACATATTCCTACAAGAGATCAATTTCTAATTTTAGGTACCCATACTTGCTTGGGTCCTCTCATGTTAGTAACAAGTGCCTTAGGCACCCAAAGTAC
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 84.80% | 10.30% | 4.97% | 0.00% | NA |
| All Indica | 2759 | 80.60% | 16.20% | 3.26% | 0.00% | NA |
| All Japonica | 1512 | 99.90% | 0.00% | 0.07% | 0.00% | NA |
| Aus | 269 | 35.30% | 13.00% | 51.67% | 0.00% | NA |
| Indica I | 595 | 79.50% | 18.50% | 2.02% | 0.00% | NA |
| Indica II | 465 | 99.40% | 0.60% | 0.00% | 0.00% | NA |
| Indica III | 913 | 73.30% | 22.90% | 3.83% | 0.00% | NA |
| Indica Intermediate | 786 | 78.80% | 15.80% | 5.47% | 0.00% | NA |
| Temperate Japonica | 767 | 99.90% | 0.00% | 0.13% | 0.00% | NA |
| Tropical Japonica | 504 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 99.00% | 0.00% | 1.04% | 0.00% | NA |
| Intermediate | 90 | 91.10% | 4.40% | 4.44% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0706189186 | G -> A | LOC_Os07g11240.1 | missense_variant ; p.Gly484Ser; MODERATE | nonsynonymous_codon ; G484S | Average:33.08; most accessible tissue: Minghui63 young leaf, score: 44.63 | possibly damaging |
1.571 |
TOLERATED | 0.11 |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0706189186 | NA | 1.29E-07 | mr1063 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0706189186 | NA | 4.53E-06 | mr1177 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0706189186 | NA | 3.21E-06 | mr1220 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0706189186 | NA | 1.14E-06 | mr1352 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0706189186 | NA | 4.79E-06 | mr1740 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0706189186 | NA | 2.36E-08 | mr1806 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0706189186 | NA | 3.80E-06 | mr1220_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0706189186 | NA | 1.35E-06 | mr1348_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0706189186 | NA | 3.71E-11 | mr1739_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0706189186 | NA | 2.06E-07 | mr1870_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |