\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0706189186:

Variant ID: vg0706189186 (JBrowse)Variation Type: SNP
Chromosome: chr07Position: 6189186
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GTACTTTGGGTGCCTAAGGCACTTGTTACTAACATGAGAGGACCCAAGCAAGTATGGGTACCTAAAATTAGAAATTGATCTCTTGTAGGAATATGTCTCC[G/A]
GTGGAAGAAGTTGGGTAATTGATAGTGGATGCACAAATCACATGACCAGAGAAGAATCAATGTTTTCAACTCTTGATCCAAATGGCACTTCACAAGATAA

Reverse complement sequence

TTATCTTGTGAAGTGCCATTTGGATCAAGAGTTGAAAACATTGATTCTTCTCTGGTCATGTGATTTGTGCATCCACTATCAATTACCCAACTTCTTCCAC[C/T]
GGAGACATATTCCTACAAGAGATCAATTTCTAATTTTAGGTACCCATACTTGCTTGGGTCCTCTCATGTTAGTAACAAGTGCCTTAGGCACCCAAAGTAC

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 84.80% 10.30% 4.97% 0.00% NA
All Indica  2759 80.60% 16.20% 3.26% 0.00% NA
All Japonica  1512 99.90% 0.00% 0.07% 0.00% NA
Aus  269 35.30% 13.00% 51.67% 0.00% NA
Indica I  595 79.50% 18.50% 2.02% 0.00% NA
Indica II  465 99.40% 0.60% 0.00% 0.00% NA
Indica III  913 73.30% 22.90% 3.83% 0.00% NA
Indica Intermediate  786 78.80% 15.80% 5.47% 0.00% NA
Temperate Japonica  767 99.90% 0.00% 0.13% 0.00% NA
Tropical Japonica  504 100.00% 0.00% 0.00% 0.00% NA
Japonica Intermediate  241 100.00% 0.00% 0.00% 0.00% NA
VI/Aromatic  96 99.00% 0.00% 1.04% 0.00% NA
Intermediate  90 91.10% 4.40% 4.44% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0706189186 G -> A LOC_Os07g11240.1 missense_variant ; p.Gly484Ser; MODERATE nonsynonymous_codon ; G484S Average:33.08; most accessible tissue: Minghui63 young leaf, score: 44.63 possibly damaging 1.571 TOLERATED 0.11

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0706189186 NA 1.29E-07 mr1063 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706189186 NA 4.53E-06 mr1177 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706189186 NA 3.21E-06 mr1220 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706189186 NA 1.14E-06 mr1352 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706189186 NA 4.79E-06 mr1740 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706189186 NA 2.36E-08 mr1806 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706189186 NA 3.80E-06 mr1220_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706189186 NA 1.35E-06 mr1348_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706189186 NA 3.71E-11 mr1739_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706189186 NA 2.06E-07 mr1870_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251