Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0706185604:

Variant ID: vg0706185604 (JBrowse)	Variation Type: SNP
Chromosome: chr07	Position: 6185604
Reference Allele: A	Alternative Allele: T
Primary Allele: A	Secondary Allele: T

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.91, A: 0.09, others allele: 0.00, population size: 78. )

Flanking Sequence (100 bp) in Reference Genome:

GATTAACCTCTCTTTTACATAAGTTGTCAACTAGGTTATTTCCCGATAATGAGATGTGGTAGATAGACCTTAATCATGACAAGGATGAAATGCATGGAGA[A/T]
AAAGCAATATGTATCACTTCTTATCTCCTACTTTTTGATAGGTTCATATATATGATTTCCATGTTATTGTTATATAAGTGTGAGACTAATGTTTACTTGA

Reverse complement sequence

TCAAGTAAACATTAGTCTCACACTTATATAACAATAACATGGAAATCATATATATGAACCTATCAAAAAGTAGGAGATAAGAAGTGATACATATTGCTTT[T/A]
TCTCCATGCATTTCATCCTTGTCATGATTAAGGTCTATCTACCACATCTCATTATCGGGAAATAACCTAGTTGACAACTTATGTAAAAGAGAGGTTAATC

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	79.60%	14.60%	0.42%	5.35%	NA
All Indica	2759	79.40%	16.90%	0.36%	3.37%	NA
All Japonica	1512	88.00%	11.60%	0.46%	0.00%	NA
Aus	269	28.30%	13.00%	0.74%	57.99%	NA
Indica I	595	78.00%	19.80%	0.17%	2.02%	NA
Indica II	465	99.40%	0.60%	0.00%	0.00%	NA
Indica III	913	72.40%	23.70%	0.77%	3.18%	NA
Indica Intermediate	786	76.70%	16.40%	0.25%	6.62%	NA
Temperate Japonica	767	91.40%	8.10%	0.52%	0.00%	NA
Tropical Japonica	504	82.50%	16.90%	0.60%	0.00%	NA
Japonica Intermediate	241	88.40%	11.60%	0.00%	0.00%	NA
VI/Aromatic	96	99.00%	0.00%	0.00%	1.04%	NA
Intermediate	90	77.80%	17.80%	1.11%	3.33%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0706185604	A -> DEL	N	N	silent_mutation	Average:25.321; most accessible tissue: Minghui63 panicle, score: 42.799	N	N	N	N
vg0706185604	A -> T	LOC_Os07g11230.1	upstream_gene_variant ; 2038.0bp to feature; MODIFIER	silent_mutation	Average:25.321; most accessible tissue: Minghui63 panicle, score: 42.799	N	N	N	N
vg0706185604	A -> T	LOC_Os07g11240.1	upstream_gene_variant ; 1418.0bp to feature; MODIFIER	silent_mutation	Average:25.321; most accessible tissue: Minghui63 panicle, score: 42.799	N	N	N	N
vg0706185604	A -> T	LOC_Os07g11230-LOC_Os07g11240	intergenic_region ; MODIFIER	silent_mutation	Average:25.321; most accessible tissue: Minghui63 panicle, score: 42.799	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0706185604	NA	5.72E-07	mr1063	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706185604	NA	1.58E-07	mr1177	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706185604	NA	2.33E-06	mr1177	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706185604	2.09E-06	2.09E-06	mr1200	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706185604	NA	9.18E-06	mr1211	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706185604	NA	5.76E-06	mr1220	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706185604	7.00E-06	7.00E-06	mr1234	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706185604	NA	5.73E-07	mr1352	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706185604	NA	2.31E-07	mr1739	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706185604	NA	1.69E-07	mr1739	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706185604	NA	2.67E-07	mr1740	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706185604	NA	5.47E-06	mr1798	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706185604	NA	4.87E-08	mr1806	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706185604	NA	2.61E-06	mr1220_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706185604	NA	1.01E-06	mr1397_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706185604	NA	3.72E-08	mr1870_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251