\
| Variant ID: vg0706170362 (JBrowse) | Variation Type: SNP |
| Chromosome: chr07 | Position: 6170362 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
CTCCGGCGTACGATTACGAGGATGACGACCTGGATCCCGGGAATCTTGTCGTTGTCTCTCGCTATTATCTCGGCGCCGATCTCCTTCGTCGTCGTCGTTG[C/T]
GACGACGGCCATGACCAGTATTGTTTGGCCCCCGCCGTTCGCGATCGTTGCATTCTGGGTCCTCGTTTGGGCGGTTTCCTCGATCATGGCGCCGTGAAGA
TCTTCACGGCGCCATGATCGAGGAAACCGCCCAAACGAGGACCCAGAATGCAACGATCGCGAACGGCGGGGGCCAAACAATACTGGTCATGGCCGTCGTC[G/A]
CAACGACGACGACGAAGGAGATCGGCGCCGAGATAATAGCGAGAGACAACGACAAGATTCCCGGGATCCAGGTCGTCATCCTCGTAATCGTACGCCGGAG
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 87.20% | 5.60% | 2.67% | 4.44% | NA |
| All Indica | 2759 | 93.90% | 0.30% | 3.01% | 2.79% | NA |
| All Japonica | 1512 | 80.80% | 16.90% | 2.25% | 0.00% | NA |
| Aus | 269 | 49.80% | 0.00% | 1.49% | 48.70% | NA |
| Indica I | 595 | 90.60% | 0.00% | 7.90% | 1.51% | NA |
| Indica II | 465 | 97.40% | 1.30% | 1.29% | 0.00% | NA |
| Indica III | 913 | 96.70% | 0.00% | 0.33% | 2.96% | NA |
| Indica Intermediate | 786 | 91.20% | 0.10% | 3.44% | 5.22% | NA |
| Temperate Japonica | 767 | 97.70% | 0.70% | 1.69% | 0.00% | NA |
| Tropical Japonica | 504 | 48.20% | 48.20% | 3.57% | 0.00% | NA |
| Japonica Intermediate | 241 | 95.40% | 3.30% | 1.24% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 87.80% | 4.40% | 5.56% | 2.22% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0706170362 | C -> DEL | LOC_Os07g11200.1 | N | frameshift_variant | Average:53.379; most accessible tissue: Minghui63 flag leaf, score: 72.028 | N | N | N | N |
| vg0706170362 | C -> T | LOC_Os07g11200.1 | missense_variant ; p.Arg223His; MODERATE | nonsynonymous_codon ; R223H | Average:53.379; most accessible tissue: Minghui63 flag leaf, score: 72.028 | unknown | unknown | TOLERATED | 1.00 |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0706170362 | NA | 1.33E-06 | mr1471 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0706170362 | NA | 1.69E-06 | mr1543 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0706170362 | NA | 3.16E-06 | mr1232_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0706170362 | NA | 1.44E-09 | mr1304_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0706170362 | NA | 9.58E-06 | mr1324_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0706170362 | 5.04E-06 | 5.04E-06 | mr1345_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0706170362 | NA | 1.01E-06 | mr1422_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0706170362 | 1.46E-06 | 1.46E-06 | mr1424_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0706170362 | NA | 1.31E-06 | mr1449_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0706170362 | NA | 7.93E-06 | mr1553_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0706170362 | 3.29E-07 | 3.29E-07 | mr1562_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0706170362 | NA | 9.58E-06 | mr1575_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0706170362 | NA | 9.78E-07 | mr1606_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0706170362 | NA | 1.15E-06 | mr1633_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0706170362 | 1.45E-06 | 1.01E-09 | mr1653_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0706170362 | NA | 9.75E-08 | mr1696_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0706170362 | 8.45E-06 | 1.74E-07 | mr1707_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0706170362 | NA | 2.30E-06 | mr1819_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0706170362 | NA | 1.21E-07 | mr1830_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0706170362 | NA | 2.05E-06 | mr1884_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0706170362 | NA | 8.89E-07 | mr1905_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |