\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0706170362:

Variant ID: vg0706170362 (JBrowse)Variation Type: SNP
Chromosome: chr07Position: 6170362
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CTCCGGCGTACGATTACGAGGATGACGACCTGGATCCCGGGAATCTTGTCGTTGTCTCTCGCTATTATCTCGGCGCCGATCTCCTTCGTCGTCGTCGTTG[C/T]
GACGACGGCCATGACCAGTATTGTTTGGCCCCCGCCGTTCGCGATCGTTGCATTCTGGGTCCTCGTTTGGGCGGTTTCCTCGATCATGGCGCCGTGAAGA

Reverse complement sequence

TCTTCACGGCGCCATGATCGAGGAAACCGCCCAAACGAGGACCCAGAATGCAACGATCGCGAACGGCGGGGGCCAAACAATACTGGTCATGGCCGTCGTC[G/A]
CAACGACGACGACGAAGGAGATCGGCGCCGAGATAATAGCGAGAGACAACGACAAGATTCCCGGGATCCAGGTCGTCATCCTCGTAATCGTACGCCGGAG

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 87.20% 5.60% 2.67% 4.44% NA
All Indica  2759 93.90% 0.30% 3.01% 2.79% NA
All Japonica  1512 80.80% 16.90% 2.25% 0.00% NA
Aus  269 49.80% 0.00% 1.49% 48.70% NA
Indica I  595 90.60% 0.00% 7.90% 1.51% NA
Indica II  465 97.40% 1.30% 1.29% 0.00% NA
Indica III  913 96.70% 0.00% 0.33% 2.96% NA
Indica Intermediate  786 91.20% 0.10% 3.44% 5.22% NA
Temperate Japonica  767 97.70% 0.70% 1.69% 0.00% NA
Tropical Japonica  504 48.20% 48.20% 3.57% 0.00% NA
Japonica Intermediate  241 95.40% 3.30% 1.24% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 87.80% 4.40% 5.56% 2.22% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0706170362 C -> DEL LOC_Os07g11200.1 N frameshift_variant Average:53.379; most accessible tissue: Minghui63 flag leaf, score: 72.028 N N N N
vg0706170362 C -> T LOC_Os07g11200.1 missense_variant ; p.Arg223His; MODERATE nonsynonymous_codon ; R223H Average:53.379; most accessible tissue: Minghui63 flag leaf, score: 72.028 unknown unknown TOLERATED 1.00

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0706170362 NA 1.33E-06 mr1471 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706170362 NA 1.69E-06 mr1543 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706170362 NA 3.16E-06 mr1232_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706170362 NA 1.44E-09 mr1304_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706170362 NA 9.58E-06 mr1324_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706170362 5.04E-06 5.04E-06 mr1345_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706170362 NA 1.01E-06 mr1422_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706170362 1.46E-06 1.46E-06 mr1424_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706170362 NA 1.31E-06 mr1449_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706170362 NA 7.93E-06 mr1553_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706170362 3.29E-07 3.29E-07 mr1562_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706170362 NA 9.58E-06 mr1575_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706170362 NA 9.78E-07 mr1606_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706170362 NA 1.15E-06 mr1633_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706170362 1.45E-06 1.01E-09 mr1653_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706170362 NA 9.75E-08 mr1696_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706170362 8.45E-06 1.74E-07 mr1707_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706170362 NA 2.30E-06 mr1819_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706170362 NA 1.21E-07 mr1830_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706170362 NA 2.05E-06 mr1884_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706170362 NA 8.89E-07 mr1905_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251