\
| Variant ID: vg0706127235 (JBrowse) | Variation Type: SNP |
| Chromosome: chr07 | Position: 6127235 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
AAGAACCAAGTATTTCCCATCTGCGTAATCCCACCACCACAGCGTACTTCTATGGGACCCAACCGGAAGTTGGGGATATACGTTGGTTATGAGACTTTGT[C/T]
CATAATCAAGTATCTTGAGTCTATGACTATGGATCTTCATACGGCTCGGTACGCTGATTGTATCTTTGATGAGGACTATTTTCCCAGCATTTGGGGGAGA
TCTCCCCCAAATGCTGGGAAAATAGTCCTCATCAAAGATACAATCAGCGTACCGAGCCGTATGAAGATCCATAGTCATAGACTCAAGATACTTGATTATG[G/A]
ACAAAGTCTCATAACCAACGTATATCCCCAACTTCCGGTTGGGTCCCATAGAAGTACGCTGTGGTGGTGGGATTACGCAGATGGGAAATACTTGGTTCTT
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 93.40% | 2.70% | 3.89% | 0.00% | NA |
| All Indica | 2759 | 90.70% | 4.20% | 5.11% | 0.00% | NA |
| All Japonica | 1512 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Aus | 269 | 81.00% | 5.20% | 13.75% | 0.00% | NA |
| Indica I | 595 | 84.70% | 5.70% | 9.58% | 0.00% | NA |
| Indica II | 465 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica III | 913 | 91.30% | 4.50% | 4.16% | 0.00% | NA |
| Indica Intermediate | 786 | 89.10% | 5.10% | 5.85% | 0.00% | NA |
| Temperate Japonica | 767 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 93.30% | 0.00% | 6.67% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0706127235 | C -> T | LOC_Os07g11090.1 | upstream_gene_variant ; 1032.0bp to feature; MODIFIER | silent_mutation | Average:50.538; most accessible tissue: Minghui63 flag leaf, score: 75.341 | N | N | N | N |
| vg0706127235 | C -> T | LOC_Os07g11080.1 | intron_variant ; MODIFIER | silent_mutation | Average:50.538; most accessible tissue: Minghui63 flag leaf, score: 75.341 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0706127235 | NA | 2.89E-07 | mr1213 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0706127235 | NA | 9.84E-06 | mr1246 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0706127235 | NA | 3.94E-07 | mr1063_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0706127235 | 4.92E-06 | 6.89E-06 | mr1348_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0706127235 | NA | 5.05E-06 | mr1469_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0706127235 | NA | 1.62E-06 | mr1511_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0706127235 | NA | 6.87E-06 | mr1721_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0706127235 | NA | 1.58E-06 | mr1743_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |